1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
13

The brain's ability to restructure its neural networks to maximize functioning after an injury is known as

Biology
1 answer:
igor_vitrenko [27]3 years ago
7 0
This capacity is known as Neuroplasticity. Neuroplasticity is the change in neural pathways and neurotransmitters that happens because of specific variables, similar to conduct, condition, or neural procedures. Amid such changes, the cerebrum participates in synaptic pruning, erasing the neural associations that are never again fundamental or helpful, and reinforcing the vital ones.
You might be interested in
What is the altitude of iota cancri
saw5 [17]
<span>I think the highest peak in iota cancri is 3.611 m #believe
</span>
4 0
3 years ago
H
Anit [1.1K]

Answer:

Law of dominance

Explanation:

It just it

3 0
3 years ago
Which situation below would have the strongest gravitational force between them?
Ad libitum [116K]
10kg mass and a 10kg mass at 10km apart
4 0
3 years ago
7.
mestny [16]

Answer:

6 hours

Explanation:

after death every hour drops to 1.5 the temperature so if you multiply 6 * 1.5 it equals 9 and if you subtract that the 97.6 which is the average heat temperature of the adult then you will get 88.6 degrees which would be around your question

6 0
3 years ago
Which of these materials do your cells need more of during exercise? why?
vfiekz [6]
Extra oxygen as your blood and heart starts pumping more blood into the body.
w/o sufficient oxygen lactic acid will form
4 0
3 years ago
Other questions:
  • What advantage does giving birth in the harshest part of winter give to the grey seal pups?
    6·2 answers
  • Which of the following species is a K-selected species?
    9·1 answer
  • All cells contain ion pumps that use the energy of atp hydrolysis to pump ions across the plasma membrane. These pumps create an
    10·1 answer
  • What cellular process is shown in the picture? Explain
    9·1 answer
  • What is a recessive genes and dominant genes
    9·1 answer
  • n this lab, you will figure out who was guilty of the classroom food mess by determining which macromolecules are present in the
    10·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which of the following is NOT true about the digestive system?<br> It’s question 10
    9·1 answer
  • (1 point)
    11·1 answer
  • Think about the job of the mitochondria. Which cells in your body would you expect have the most mitochondria? Explain your reas
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!