1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
2 years ago
6

What is Hygiene and its Importance? Yeah and Don't copy from Goo gle

Biology
2 answers:
Gnoma [55]2 years ago
8 0

Answer:

Hygiene is a series of practices performed to preserve health.

Explanation:

Good hygiene can maintain our health and protect us from different diseases which may cause by unhygienic food or germ-infested activities.

zimovet [89]2 years ago
5 0
Hygiene is to take care of your body and the importance is hygiene can protect our health from disease
You might be interested in
Which two types of molecules are formed as a product of cellular respiration?
Cloud [144]

Answer:

carbon dioxide and water

Explanation:

the most simple answer would be co2 and h20 since they are two molecular waste products formed as a result of cellular respiration, but ATP is also a product and is a molecule. So the question itself is faulty, since there are three products in cellular respiration.

It depends on how you learned it, but it says 2 so I would go with CO2 and H20.

8 0
3 years ago
Read 2 more answers
What are four examples of cells that go through mitosis?
vlada-n [284]
Some organisms that reproduce asexually are hydra, bacteria, and single celled organisms. Meiosis is the production of sperm<span> and egg cells. These cells are "Gamete" or "Sex" cells. Each cell has to go through the division process twice in order for the cell to end up with half the number of </span>chromosomes<span>. brainly answer pls

</span>
5 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Glycolysis is a body process which involves: a.the passage of water through a semipermeable membrane b.the division of the nucle
skelet666 [1.2K]
<span>the initial breakdown of glucose to pyruvic acid is the write option.
So i say it is D</span>
7 0
3 years ago
Cells that are specialized
Brums [2.3K]

Answer:

Perform different functions for the organisms

Explanation:

1-Stem cells can differentiate into other specialized cells.

2-Specialized cells are more complex.

3-Specialized cells usually do not reproduce

6 0
2 years ago
Other questions:
  • Is the dermis of the skin composed of dense regular or dense irregular connective tissue?
    11·1 answer
  • A new mutation that arose in one copy of gene Xin a somatic cell resulted in the formation of atumor. Which of the following pie
    12·1 answer
  • Bethany consumes a very-low-carbohydrate diet that supplies less than 100 g of carbohydrate daily, but she eats high amounts of
    9·1 answer
  • Write the similarities and diffrences between Dichotomous keys and Cladograms
    6·1 answer
  • Field mice are sexually-reproducing organisms. In a population of field mice, traits that promote survival and reproduction are
    9·2 answers
  • PLEASE HELP!!! <br><br> Atomic number is the same as number of ______.
    10·2 answers
  • Phillip was performing a laboratory exercise on how temperature affects a plant's cellular activity. He discovered that when exp
    9·1 answer
  • Which of the following can
    14·2 answers
  • What must be true if the mesentery is an organ? Choose the three statements that apply.
    14·1 answer
  • Would extrusive or intrusive igneous rocks have the largest crystals? Why
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!