It seems that you have missed the necessary options for this statement to be complete, but anyway, here is the correct answer. The first of the two undeniable facts is that any localized population of a species has the potential to produce far more offspring than the local environment can support. this fact is important to understanding evolution because it means that <span>the population will ultimately overwhelm its environment, causing the environment to collapse. Hope this answer helps.</span>
        
             
        
        
        
Most bacteria rely on binary fission for propagation. Conceptually this is a simple process; a cell just needs to grow to twice its starting size and then split in two. But, to remain viable and competitive, a bacterium must divide at the right time, in the right place, and must provide each offspring with a complete copy of its essential genetic material. Bacterial cell division is studied in many research laboratories throughout the world. These investigations are uncovering the genetic mechanisms that regulate and drive bacterial cell division. Understanding the mechanics of this process is of great interest because it may allow for the design of new chemicals or novel antibiotics that specifically target and interfere with cell division in bacteria.
 
        
             
        
        
        
Answer:
c, recesive
Explanation:
x chromosomes are usually recesive
 
        
             
        
        
        
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA    ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON          UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA    TTTACGGCCATCAGGCAATACTGG
- mRNA     AAAUGCCGGUAGUCCGUUAUGACC
- CODON          AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr