1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex17521 [72]
3 years ago
5

Which of the following is a product of photosynthesis?

Biology
1 answer:
monitta3 years ago
5 0
During the process of photosynthesis<span>, plants use energy from the Sun to convert carbon dioxide and water into glucose and oxygen. </span>These products<span> are, in turn, used by the plant or animals that eat the plant during cellular respiration to produce ATP. So it would be Carbon dioxide. Hope this helps. :)</span>
You might be interested in
The first of the two undeniable facts is that any localized population of a species has the potential to produce far more offspr
Mars2501 [29]
It seems that you have missed the necessary options for this statement to be complete, but anyway, here is the correct answer. The first of the two undeniable facts is that any localized population of a species has the potential to produce far more offspring than the local environment can support. this fact is important to understanding evolution because it means that <span>the population will ultimately overwhelm its environment, causing the environment to collapse. Hope this answer helps.</span>
4 0
3 years ago
Number the steps of the binary fission process in the correct order
Naya [18.7K]

Most bacteria rely on binary fission for propagation. Conceptually this is a simple process; a cell just needs to grow to twice its starting size and then split in two. But, to remain viable and competitive, a bacterium must divide at the right time, in the right place, and must provide each offspring with a complete copy of its essential genetic material. Bacterial cell division is studied in many research laboratories throughout the world. These investigations are uncovering the genetic mechanisms that regulate and drive bacterial cell division. Understanding the mechanics of this process is of great interest because it may allow for the design of new chemicals or novel antibiotics that specifically target and interfere with cell division in bacteria.



5 0
3 years ago
In humans if a trait is passed on the X chromosome then the trait is
vovangra [49]

Answer:

c, recesive

Explanation:

x chromosomes are usually recesive

3 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
At what point in the development of the embryo do you think a pregnant woman must begin to increase the number of calories she c
Gekata [30.6K]
Between four and seven months
4 0
3 years ago
Read 2 more answers
Other questions:
  • To living organisms, the most dangerous debris from tephra is probably _____, because it spreads so widely. huge volcanic boulde
    13·2 answers
  • A bend in a river shaped like a loop is called a(n) _____________
    14·2 answers
  • Scientists can track the movement of proteins through the endomembrane system using an approach known as a pulse-chase experimen
    13·1 answer
  • One way the North Atlantic Ocean is different from the South Pacific
    12·1 answer
  • The scientific name for a polar bear is Ursus maritimus. The scientific name for an American black bear is Ursus
    14·1 answer
  • Which of the following would be the best way to restore a forest to its natural state and increase the biodiversity of an area t
    8·1 answer
  • Which molecule provides the amino acids that are assembled during translation ?
    12·1 answer
  • What are the nutrients which undergo digestion ? just give answer in very simplest form?​
    5·2 answers
  • Please I need help with biology hw
    6·1 answer
  • Purpose
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!