1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
azamat
3 years ago
11

UMM who's good at science bc i need help?!?!?!

Biology
1 answer:
jarptica [38.1K]3 years ago
5 0
<span>The heat comes from the outer core, which provides the heat.</span>
You might be interested in
How do scientists most often gain new knowledge
lions [1.4K]

Answer:

Scientists mostly gain new knowledge through direct observation and applying the scientific method. They would start with a hypothesis and test it, then change it or confirm it. Others would test their confirmation from one point, while the third group would test what the second said. And so on and so forth.

Explanation:

3 0
3 years ago
Name classifications of matter used In the 1800
Veronika [31]
The choices can be found elsewhere and as follows:

<span>atural and synthetic
metabolites and nonmetabolites
proteins, carbohydrates, lipids, and nucleic acids
organic compounds and inorganic compounds

I think the correct answer from the choices is the third option. The c</span>lassifications of matter used In the 1800 are proteins, carbohydrates, lipids, and nucleic acids. Hope this helps.
8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Which of the following represents an example of Mullerian mimicry?
Mumz [18]
<em>the correct option for this is B>></em>
5 0
3 years ago
Which element is the basis for all living things and can combine with other elements in many ways?
Vika [28.1K]
Carbon is the basic element for living thing
4 0
2 years ago
Other questions:
  • What are 3 human activitys that threaten biodiversity
    12·1 answer
  • 1. Which type of wave vibrates both side to side and up and down?
    10·2 answers
  • The theory of evolution describes
    14·2 answers
  • Explain the composition the simplest chemical compound.
    13·1 answer
  • Cell membrane meaning
    12·1 answer
  • Meiosis involves how many cell divisions?
    11·2 answers
  • Which are examples of harmful mutations? Check all that apply.
    10·1 answer
  • Gender role, gender identity, amd sexual orientation vary with each individual. True or False?​
    10·2 answers
  • How long is the Lechuguilla cave?
    11·1 answer
  • What is the number of different species of plants and animals in an area
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!