1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
9

How do viruses replicate their genome viral dna to complementary dna?

Biology
1 answer:
denis-greek [22]3 years ago
3 0

Answer:

Reverse transcriptase, a viral enzyme that comes from the virus itself, converts the viral RNA into a complementary strand of DNA, which is copied to produce a double stranded molecule of viral DNA. This viral DNA is then transcribed and translated by the host cell's machinery, directing the formation of new virions

Explanation:

You might be interested in
An experiment is designed to determine if wheat grows better when it is planted alone or with clover. The design calls for 3 pan
Viktor [21]

Answer: Option B

Explanation:

Usually in scientific experiments, at least one parameter is checked; here, the growth rate of wheat in two different conditions is being evaluated.

Hence, growth rate of wheat alone in pans A, B and C becomes the standard or referential control against which the experimental control (Wheat + clover) in pans D, E and F is evaluated, since both treatments are exposed to the same external conditions.

I hope this helps

4 0
3 years ago
The mass of a star can be determined by studying _____.
Lilit [14]

<u>Answer</u>:

The mass of a star can be determined by studying binary star systems.

<u>Explanation</u>:

In this system it consists of two stars, revolving round the same bary-centre. The systems having two or may say more than two are called as the multiple star system. This zone is also a habitable zone, here the water exists in the liquid form. We could have sometime seen the two stars together. They are also very capable of strengthening the terrestrial planets inside the stable orbital ranges. They have generally two orbits like P-type as well as circumbinary.  

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which of the following is a food chain that can be made fro this food web
neonofarm [45]

B

Only reasonable answer

6 0
2 years ago
___________ waves cause most of the damage during an earthquake. primary secondary body surface
Finger [1]
Surface waves cause most the the damage

7 0
3 years ago
Other questions:
  • What do scientist use to learn about Earth's core
    11·2 answers
  • 17. Which big idea in biology revolves around the idea that all life forms on Earth are connected and linked
    11·2 answers
  • Are pictures of relationships
    13·1 answer
  • Which gas supplies the energy for storms
    7·1 answer
  • If the potato cells decreased in mass what was lost from the cells:
    13·1 answer
  • Lab work. Which rna nucleotide can pair with the thymine at the beginning of the strand? Drag it into the DNA antisense strand t
    7·2 answers
  • inhibition is a mechanism of succession in which Group of answer choices the arrival of one species at a site affects the subseq
    9·1 answer
  • How do genes get expressed in an organism?
    14·1 answer
  • A _______________________ recognizes and destroys cells infected by a virus.
    10·2 answers
  • Which type of microscope has the lowest magnification power?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!