Answer:
D) 70
Explanation:
Vertical is going up so it would the highest number.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Woman's genotype: ii
Husband's genotype: I^A i
-> possible husband's father genotypes are two I^B and I^B i
-> if husband's father has two I^B alleles, the husband will have one I^B allele present, which is not the case. So, there is i allele present. (can also infer that I^A comes from husband's mother)
Child's possible genotypes:
ii, ii, I^A i, I^A i
probability is 1/2
