1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
Structure A is a _____.
Nookie1986 [14]

Answer:

solute

Explanation:

The cell membrane with an integral molecule that consists of two similar parts with a specific recess. There are many particles in the extracellular fluid. One of these particles is labeled A.

Structure A is a solute

Solute refers to the component which is dissolved in the solvent.

The solvent is the substance in which the solute is dissolved.

7 0
3 years ago
Cheese and yogurt are products of which of the following processes?
nadya68 [22]

Answer:

Lactic acid fermentation

Explanation:

8 0
3 years ago
Read 2 more answers
If pathogens are present a tree is likely to have
const2013 [10]

Answer:

a. a disease

Explanation:

Pathogens are disease-causing organisms. For example, some bacteria and viruses are pathogens for different species.

Therefore, a tree with pathogens present is likely to have a disease. Different pathogens affect different trees. Examples include Anthracnose , which is caused by a fungus

5 0
3 years ago
Control-part of the body that determines what to do with the information about the change in setpoint (I will give brainliest)
Ann [662]

Answer:

Hypothalamus

Explanation:

The hypothalamus is involved in different daily activities like eating or drinking, in the control of the body's temperature and energy maintenance, and in the process of memorizing and in stress control. It also modulates the endocrine system through its connections with the pituitary gland.

4 0
3 years ago
Someone please help :) I would really appreciate it ​
sammy [17]

Answer:

oxygen

Explanation:

8 0
3 years ago
Other questions:
  • PLZ HELP ME........
    5·1 answer
  • A(n)_____tells what will happen under certain conditions
    7·1 answer
  • True or false? the ovaries secrete a hormone that assists with labor and delivery.
    15·1 answer
  • Name the three types of population distribution, describe each, and explain the conditions that govern each.
    13·2 answers
  • In which structure would both mitosis and differentiation of an embryo occur?
    15·2 answers
  • If one parent has homozygous dominant tall gene and another parent has heterozygous tall gene, what's the probability of having
    14·1 answer
  • 16
    7·1 answer
  • Help me !! How did i figure out what scale to write on the y-axis of my graph ? please help !!!!!
    7·1 answer
  • Which of the following descriptions of proteins are true?
    13·1 answer
  • The elements or compounds that come out of a chemical reaction are?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!