1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
Can someone summarize The dual visual system to me AND color vision, like blindness etc...
Oduvanchick [21]

Dual visual system:

Dual visual system is nothing but the different visual systems that our brain is meant to direct.

The two visual systems are

  • Dorsal Stream
  • Ventral Stream  

Dorsal Stream:

Dorsal stream is mainly referred as a vision of action. This visual system is involved in moment by moment analysis. It is also known as where stream.

Ventral Stream:

Ventral stream is mainly referred to as the vision of perception. This visual system is meant to analyse and recognize shape and object etc. It is also known as What stream

Blindness:

Blindness is a defined as the lack of vision. Such type of vision loss can't be corrected either by contact lens or through glasses.

There are two type of blindness,

  • Temporary Blindness
  • Permanent Blindness

Temporary blindness is a condition where the vision of an individual vision is limited.

Permanent Blindness is a condition where an individual can't see anything even the light

8 0
3 years ago
A decreased amount of potassium in the blood due to a diuretic drug is known as:
goldenfox [79]
<span>This is hypokalemia. The diuretic drug will, in this case, cause the kidneys to excrete more urine (and therefore more potassium) than usual, leading to a lowered amount in the body. By changing the dose of the diuretic, the patient can have their levels brought closer to normal.</span>
7 0
3 years ago
Cells are small simple mechanisms.<br> True Or False?
fomenos

Answer:

True

Explanation:

6 0
2 years ago
Read 2 more answers
A chromosomal alteration in which one or more pairs of homologous chromosomes fail to separate normally during meiotic cell divi
Lostsunrise [7]

Answer:

an Aneuploidy

Explanation:

Aneuploidy is the presence of an abnormal number of chromosomes in a cell

6 0
3 years ago
Maria's mother was deported six months ago, and she is staying with a cousin. She has to share a room with three other children
enot [183]

major depression ( apex )


6 0
3 years ago
Other questions:
  • Which statement is supported by the cladogram?
    6·1 answer
  • Define autotrophs, heterotrophs, producers, and photoautotrophs.
    14·1 answer
  • When swallowing, the epiglottis prevents food from entering the larynx?
    15·2 answers
  • Polarized cells are characterized by _________________. a) random orientation within a tissue b) formation of several connected
    10·1 answer
  • It is a small RNA molecules that interfere with gene expression.
    7·1 answer
  • Please helppp i’ll mark u the brain thingggg !!!!!!
    10·1 answer
  • Why is it impossible for male calico cats to exist
    15·1 answer
  • A : chromatid<br> b : centroemere<br> c : single strand chromosome<br> d : double strand chromosome
    14·1 answer
  • 2. What term describes the formation of water droplets on the outside of a glass of cold water on a hot day?
    12·1 answer
  • What are the cons of fetal stem cells
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!