1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
4 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]4 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
Four patients have been diagnosed with medical issues.
Igoryamba

Answer:

The correct answer is "Ashley, Ron, and Lindsay".

Explanation:

Ultrasound technology is used for medical purposes by a scanning machine that allows to obtain living images of the inside of the body. For the type of issues they are going trough, ultrasound technology would help patients Ashley, Ron, and Lindsay. Ashley's under-developing fetus, Ron's kidney stones and, Lindsay's uterus cancer can be monitored by using ultrasound technology. I attached the missing table.

4 0
3 years ago
Read 2 more answers
Each end of the mandible is attached to the temporal bone of the cranium at the moveable __________ joint.
stiv31 [10]
Temporomandibular Joint.
6 0
3 years ago
PLEASE I NEED HELP ASAP :(
statuscvo [17]

Answer:

b

Explanation:

the rest just wont help when you are trying to identify them

3 0
3 years ago
What kind of galaxy has arms of gas and dust?
Romashka [77]
Spiral Galaxy... This is the answer...
7 0
4 years ago
Read 2 more answers
Landform F is a headland. Describe the effect of waves on the headland and predict how it will change over time.
GaryK [48]

Given that Landform F is a headland.

The effect of waves on the headland – Energy from waves will be concentrated on the headland.

How the headland will change over time – The headland will erode and level out with the rest of the shore.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Gabriel is experiencing psychosocial stress during a job interview. which area of gabriel's brain is responsible for initially p
    15·1 answer
  • In a genetic disorder called xeroderma pigmentosum, an enzyme needed to repair sunlight-induced dna damage is lacking. this auto
    7·1 answer
  • I need help answering these, any help is appreciated! It’s for APES (AP Environmental Science)
    10·1 answer
  • The goal of applied Sciene
    12·2 answers
  • How does the law of conservation of matter relate to the energy of transfer in the atmosphere?
    8·1 answer
  • Ideas on a science experiment that has to do with marine science?​
    5·1 answer
  • What is the atomic number of this atom?<br> a<br> O 8<br> O 13<br> 09<br> O 5<br> 04
    7·1 answer
  • Please answer these questions as soon as possible.
    9·1 answer
  • Green plants and algae make their own food through photosynthesis. What is photosynthesis?.
    12·1 answer
  • Explain human digestive system​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!