1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
4 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]4 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
There are 5 major types of asexual reproduction. Name all 5 and give an example of each.
Nookie1986 [14]

Asexual reproduction involves only one parent and the offspring is identical to the parent. An example of an organism that reproduces asexually is Archaea or bacteria. Sexual reproduction involves two parents and the offspring's genes are equally contributed by each parent. An example of organisms that reproduce sexually are some land mammals. The chromosomes of a parent and offspring in asexual reproduction are identical and there is no difference in the chromosomes. 

8 0
4 years ago
Read 2 more answers
which statementbest describes the environmental impact of the radioactive waste produced in fission reaction
iVinArrow [24]

The impact of radioactive waste on the environment has the potential effect to be devastating if improperly stored/managed. The largest threat posed would be if radioactive waste was leaked from containment. Some waste has the potential to cause biological harm if inhaled or ingested. Leakage of radioactive material can render areas of the environment uninhabitable. Seeing as radioactive material can have a half life from hundreds of years to thousands it is imperative it is correctly contained.

5 0
4 years ago
True or false:Winds are named by the direction they come from.<br> 
pickupchik [31]
Pretty sure that’s false
5 0
3 years ago
Read 2 more answers
Which statements accurately describe soil? Check all that apply.
ahrayia [7]

Answer:

Soil condition directly affects crop growth.

Explanation:

Soil condition affects the crop growth directly. If a soil is in fertile condition then the growth of crop which is growing in such soil will be good but if the soil is infertile then the crop will not grow to its fullest. A fertile soil is the one which has optimum condition for growth of a crop like suitable pH, moisture retention capacity, good amount of nutrients & minerals like nitrogen, phosphorus, sodium, potassium, magnesium etc. If a soil is rich in all these constituents then the crop which is growing in this soil will be healthy. But, if a soil is infertile then the crop which is growing on that soil will be under stress and will not be able to grow completely.

3 0
4 years ago
Read 2 more answers
Does hydrogen and helium act almost like a furnace in the sun?
viktelen [127]

Answer:

Yes

Explanation:

Two isotopes of hydrogen, tritium and protium, undergo nuclear fusion in the sun to give helium, neutrons and a tremendous amount of energy. This reaction occurs at the very high temperature found in the sun and yields tremendous amount of energy.

Given the high temperature at which the said fusion reaction occurs, it is safe to say that hydrogen and helium act as a furnace at the core of the sun.

8 0
3 years ago
Other questions:
  • What pattern of growth will a population with limited resources show? *
    15·1 answer
  • A feature that is not present in all female mammals is
    5·1 answer
  • ____ intelligence is defined as involving the skills and knowledge necessary for adapting to one’s physical and social environme
    11·1 answer
  • All genetic mutations reduce a species chances for survival.<br> a. True<br> b. False
    12·1 answer
  • During what phase of mitosis do centermeres divide and the chromosomes move toward their respective poles
    7·1 answer
  • Is a robot an open, closed, or isolated system? <br> EXPLAIN WHY.
    15·1 answer
  • The rock cycle is defined as what?
    10·1 answer
  • How might the increase of volcanic eruptions affect Earth? It might produce more ozone in the atmosphere It might decrease tempe
    11·1 answer
  • Which contains the Hydrophobic Tail<br> 1- Plant cell <br> 2- Animal cell<br> 3- Both
    7·1 answer
  • Which substance is coded by a length of dna
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!