1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
What is a geostrophic wind? Why would you not expect to observe a geostrophic wind at the equator?
elena-14-01-66 [18.8K]

A theoretical wind known as the geostrophic wind is produced when the Coriolis effect, as well as the pressure difference forces, are balanced (PGF). It is a decent estimate for the wind reported at middle latitudes at an altitude of greater than 1 km. Given that there is no Coriolis effect near the equator, there can be no geostrophic wind.

What does "geostrophic wind" mean?

Geostrophic flow, as used in atmospheric research, is the fictitious wind that would emerge from a precise balancing act between the Coriolis effect and the pressure difference forces. The term "geostrophic equilibrium" or "geostrophic balance" refers to this situation (also known as geostrophy). Parallel to the isobars is where the geostrophic wind is pointed. In nature, this equilibrium seldom occurs perfectly. Because of these factors, the genuine wind and geostrophic wind nearly never match up.

The location of geostrophic winds:

At elevations exceeding 1000 meters (3300 feet), geostrophic wind can be found. With the use of weather balloons, the geostrophic wind velocity may be calculated. At heights up to 100 meters, the ground surface has a significant impact on winds.

Learn more about the Coriolis effect here:

brainly.com/question/14290551

#SPJ4

4 0
1 year ago
What is the main difference between the linings of the small and large intestines?
3241004551 [841]
The small intestines have microvilli in the lining which help to increase the surface area of the small intestines and help to absorb nutrients. 
7 0
3 years ago
The respiratory system branches like the circulatory. Oxygen and carbon dioxide diffuse between the end of these branches and th
Feliz [49]

Answer:

1. Ends of the respiratory branches are called alveoli.

2. C. To control blood flow to different areas of the body depending on activities

Explanation:

1. The trachea divides into left and right primary bronchi which in turn divide multiple times upon entering the lungs and make the bronchial tree.

The final branches of the bronchial tree are the terminal bronchioles that lead to alveoli. The alveoli are the balloon-shaped structures and serve as the site of gas exchange between the blood and inhaled air.  

2. The opening and closing of sphincters of capillary beds regulate the direction of blood flow. The opening of sphincters allows the blood to flow into associated branches of capillary beds while closed sphincters direct the blood from arterioles to venules via thoroughfare channel.

This local change in blood flow is responsible for the autoregulation of blood flow to different tissues to match their respective metabolic demands. For example, during physical activity, more blood is directed to skeletal and cardiac muscles.

8 0
3 years ago
What happens to the nuclear membrane after prophase?
nasty-shy [4]
<span>At the end of prophase , nuclear membrane , nucleolus and all the cell organelles disappears and there is no distinction between the nucleoplasm and cytoplasm</span>
4 0
2 years ago
What are some ways to increase carbon dioxide? To reduce carbon dioxide?
Brut [27]

<u>Some ways to increase carbon dioxide and To reduce carbon dioxide:</u>

WAYS TO INCREASE CARBON DIOXIDE

  • Consuming electricity: The main reason for the CO_2 emission is the burning of fossil fuels. 41% of the CO_2 emitted  in the US form generating electricity.
  • Deforestation: cutting of trees increases the CO_2 in the atmosphere.

WAYS TO REDUCE CARBON DIOXIDE:

  • Reuse and recycling: By buying used products and reselling or recycling are reduce your carbon emissions.
  • Planting more trees: trees are used to stored the removed CO_2 from atmosphere CO_2 helps the plants for photosynthesis. so plant more trees.
8 0
3 years ago
Other questions:
  • After a dietary assessment is completed, it reveals that a client consumes 50% of daily calories from fat. this amount of fat pl
    11·1 answer
  • Antlions can experience competition when...?
    7·2 answers
  • Where do female pillbugs carry their young
    13·1 answer
  • In a cell, what is the function of the cell membrane? It controls the entry and exit of substances. It removes waste and stores
    14·1 answer
  • Albumin is a protein found in egg whites.
    10·1 answer
  • The part of the ear that vibrates first when sound waves enter the ear is the
    5·1 answer
  • Please help me in number 2 question, Thanks
    15·1 answer
  • What is the name for a large region with consistent organisms and weather?
    6·2 answers
  • What most directly enables salmon to swim in a river
    13·1 answer
  • HELP due today in 5 min DONT G O O G L E USE or I’ll get an F
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!