1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
11. Who suggested that peppered moths were an example of natural selection?
weeeeeb [17]

Answer:

J. W. Tutt suggested that peppered moths were an example of natural selection.

Explanation: Before industrial revolution, the population of white peppered moth is high as compared to dark peppered moth because white peppered moth can't be seen at night by the birds. After industrial revolution, sooth is spread on the surface of the trees which make easy for the bird to see white peppered moth and feeds on them. Population of white peppered moth decreases while the population of dark peppered moth increased because they cannot be seen in the dark due to black color of sooth.

3 0
3 years ago
One advantage of having a cloned flock
Cerrena [4.2K]
It eliminates certain genetic diseases or bad traits for the flock.
4 0
3 years ago
Read 2 more answers
If the gfr is too low, needed substances may pass so quickly through the renal tubules that they are not absorbed and instead ar
stich3 [128]
The statement above is FALSE.
Glomerular filtration is the process by which the kidneys filter the blood by removing excess wastes and fluid. Glomerular filteration rate [GFR] is a measure of how well the blood is filtereed by the kidney. If the value of a GFR test is too low that indicates that the kidney is not working well.  <span />
4 0
3 years ago
Can someone please help
kondaur [170]

Answer:

Look at the

Explanation:

Lm

5 0
3 years ago
Read 2 more answers
Which of the following statements is NOT true regarding ATP production in muscles during periods of prolonged energy use, such a
Marysya12 [62]

Answer:

C.In the absence of oxygen, creatine phosphate can drive aerobic respiration pathways for a few minutes.

Explanation:

C. In the absence of oxygen, creatine phosphate can drive aerobic respiration pathways for a few minutes.

This statement  not true for a following reasons.

Firstly,  creatine phosphate directly phosphorylates ATP instead of providing any support for aerobic pathways.

Secondly, creatine phosphate stores are used up in about 15 seconds only. Thirdly, a cell does not need  oxygen deficit for creatine phosphate to be activated, it just needs to be short on ATP.

4 0
3 years ago
Other questions:
  • If analogous structures are often examples of convergent evolution what types of structures would likely be examples of divergen
    5·2 answers
  • Which of these does not contain helpful bacteria?
    10·1 answer
  • Explain why molecules do not have electric charge
    8·1 answer
  • What is the gel-like fluid that fills the cell and surrounds the organelles?
    8·2 answers
  • The "calico" pattern of coat coloration in female cats is a result of:__________
    8·1 answer
  • What are the largest and most stable ecosystems on earth
    9·1 answer
  • What is the difference between embryonic stem cells and adult cells?
    7·1 answer
  • A hypothesis becomes a theory:
    15·1 answer
  • According to the graph, how many billions of US dollars were invested in sustainable energy in 2006?
    13·1 answer
  • Pls help me unjumble and guess the words ty​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!