1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
Extinction is the dying out of a species. What can
Svetllana [295]

Answer:

O

Explanation:

O having traits that enable the spices to adapt to the changed enviroment

5 0
3 years ago
What is the name of the unique area (specific region) that a lymphocyte recognizes and binds to?
AlladinOne [14]

Answer:

a. antigen

Explanation:

The Immune system is composed of immune cells  that  defend the body against foreign substances such as bacteria or virus. Lymphocytes (B and T cells) are one of the main immune cells

Lymphocytes have the ability to recognize and bind to antigens, wich are substances foreign to the body ( i.e bacterial or virus elements) that evokes an immune response.

6 0
3 years ago
There are twenty amino acids in living organisms. Ten of these are referred to as essential amino acids. Why are they called ess
Dahasolnce [82]

Answer:

B

Explanation:

3 0
4 years ago
Read 2 more answers
What is selective breeding?
soldi70 [24.7K]

Answer:

A

Explanation:

7 0
3 years ago
Read 2 more answers
Which is not a topic of biology?
andre [41]
A. the distribution of sand on an ocean floor
3 0
3 years ago
Read 2 more answers
Other questions:
  • Why are platypus,brown bear,lion,and house cat thought to be related to each other?
    7·1 answer
  • Qué es un cromosoma?
    7·1 answer
  • During which phase of mitosis does the nuclear envelope reform?
    14·2 answers
  • A patient with hyperlipidemia has been prescribed simvastatin. the nurse instructs the patient to undergo a liver function test
    6·1 answer
  • Select all the true statements concerning mitosis.
    10·1 answer
  • Compare and contrast the polyp and medusa stages of a typical jellyfish.
    6·1 answer
  • Which phrase describes one characteristic of radioactive elements
    7·2 answers
  • When an earthquake occurs energy radiates in all directions from its source which is called the what
    12·2 answers
  • Submit your air quality report for your area, showing seven days, the air quality color for each day, and each day's major
    6·1 answer
  • Pls help I’m way too dum: If water is continuously moving through the water cycle, why is it so important to conserve water?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!