1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
A single strand of DNA helix consists of 100 nitrogenous base pairs. If 36 of the bases are adenine and 24 are cytosine, how man
Scorpion4ik [409]
If adenine and thymine are complimentary pairs, and we're finding how many thymine there should be in the case that there are 36 adenine bases, there would be 36 thymine bases.
8 0
3 years ago
Prokaryotes reproduce by ___________, which creates _____ exact daughter cell clone(s) of the original parent cell.
ZanzabumX [31]
Prokaryotes reproduce by *BINARY FISSION* which creates *2*exact daughter cell clone(s) of the original parent cell.
4 0
3 years ago
Water plays a role in body temperature regulation. <br> a. True <br> b. False
Mrrafil [7]
The answer is:
True - 
Water<span> enables the </span>body<span> to release heat when ambient </span>temperature<span> is higher than </span>body temperature<span> </span>
7 0
3 years ago
Read 2 more answers
Help please I’ll give brainliest
kotykmax [81]

Answer:

ok i rlly hope this helps

Explanation:

mass/volume=density

.0057/.0235

=.2425531915 kg/L

=.24 kg/L

6 0
3 years ago
Serological testing is based on the fact that: Select one:
mihalych1998 [28]

Answer:

B. Antibodies react specifically with an antigen.

Explanation:

Serological tests are blood tests that look for antibodies in your blood. They can involve a number of laboratory techniques. Flucculation tests are based on the precipitation that takes place when antibody and specially prepared antigens are mixed together

7 0
3 years ago
Other questions:
  • What is the definition of glacier
    10·1 answer
  • Whaere is the nucleus found
    15·2 answers
  • 50 things that use electricity
    7·1 answer
  • Several butterflies within a large population have wings with large dots on them. This wing pattern warns predators not to eat t
    8·2 answers
  • What are two issues with Lamarks theory of evolution!!!<br><br> I will mark brainest!!!!! Pls
    10·1 answer
  • What represents the presence of the rehesus protein on blood
    9·2 answers
  • Como se organizan las celulas para formar diversas estructuras en los seres vivos
    9·1 answer
  • Which carboyhydrate can be used by the body as an immediate source of energy?
    12·1 answer
  • How does Radiant energy travel?
    11·2 answers
  • Why does the land on earth appear to be stable when in fact it is changing?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!