1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
Give a scenario in which a new ecosystem would be created
miss Akunina [59]
Global warming. if the world pollutes too a certain level of extreme , a new ecosystem would do some good
7 0
3 years ago
DNA replication results in:
valkas [14]

Answer:

1 new DNA molecule, 1 old molecule is conserved

5 0
3 years ago
Read 2 more answers
What was the purpose of mendels experiments with dihybrid crosses
kolbaska11 [484]

Answer:

The relationship data of the dominance for each trait between the alleles was available with Mendel. The purpose of the dihybrid cross was to determine the type of relationship that existed between the pair of alleles.

3 0
3 years ago
The spinal cord is most important for: Group of answer choices Production of routine behaviors, such as walking Voluntary behavi
djverab [1.8K]

Answer:

Receiving sensory information and carrying commands to the muscles.

Explanation:

The spinal cord serves as the transmission conduit  for the passage of action potential as sensory information through the sensory/afferent neurons to the dorsal roots of the spinal cord.The information  synapse with the inter neurons,branching off to the brain and emerged as the  response through the motor/efferent neurons to the effectors(muscles).

This pathways is called reflex arc. Thus most of the involuntary action of the body is conducted through the spinal cord

4 0
2 years ago
Read 2 more answers
How far back are ancestors ?
ivann1987 [24]

Answer:

The Last Universal Common Ancestor (LUCA) is the most recent common ancestor of all current life on Earth, estimated to have lived some 3.5 to 3.8 billion years ago

pls mark brainliest

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • What type of normal human cell contains 22 autosomes and a y chromosome? what type of normal human cell contains 22 autosomes an
    12·1 answer
  • How did gibbons v ogden expand the idea of federal supremency
    11·2 answers
  • What is energy efficiency? Explain why we can think of energy efficiency as an energy resource. What percentage of the energy us
    11·1 answer
  • Which of the following is not an autotroph
    7·2 answers
  • Why do you think people believe some theories even if they´re not supported by scientific evidence?
    6·1 answer
  • How do limiting factors affect the carrying capacity of an inviroment?
    10·1 answer
  • As you move across a row from left to right in the period table, atomic numbers of the elements
    7·1 answer
  • There are six people in the Fisher family. Olivia and Marcus are the parents. They have four children: Violet, Nathan, Jonas, an
    10·2 answers
  • Which of the following is NOT a characteristic of all living things?*
    7·1 answer
  • When a person needs a gradual increase in the amount of a psychoactive drug to produce the desired effect, _____ has occurred.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!