1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]3 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
If Avery had observed transformation using only the extracts containing degraded DNA, degraded RNA, and degraded protein, but NO
Leokris [45]

Answer:

Polysaccharides are the genetic material.

Explanation:

Avery did not observe transformation using the extracts containing degraded DNA. On the other hand, extracts with degraded RNA, proteins, and polysaccharides exhibited transformation. Therefore, he concluded that DNA is the genetic material responsible for transformation. If he would have observed the process of transformation using extracts containing degraded DNA but not with degraded polysaccharides, he might have concluded that "polysaccharides were the genetic material responsible for the process of transformation."

4 0
3 years ago
Doctors do not administer vaccinations to people who are too sick. Which best explains why?
zvonat [6]

Answer: D

Explanation:

7 0
3 years ago
Read 2 more answers
HELP!!! NEED HELP!!!
Pavel [41]

ab is the answer please give me brainleist answer

7 0
3 years ago
MRNA directs the building of proteins through a sequence of
Ad libitum [116K]

Answer:

The mRNA interacts with a specialized complex called a ribosome, which "reads" the sequence of mRNA bases. Each sequence of three bases, called a codon, usually codes for one particular amino acid. (Amino acids are the building blocks of proteins.)

Explanation:

5 0
2 years ago
2 Points
alina1380 [7]

Answer:

The answer is:

B. Worms consuming the blood from mammals.

Algae isn't causing any harm to the sloth, rather its providing it with camouflage to hide from predators. Both creatures benefits since the algae gets to eat any parasites and other things in the sloths fur, plus they get a free ride and home in the process. The sloth isn't harmed and is helped by the algae since it provides camouflage (mutualism).

Tree frogs aren't causing harm to the trees since they are only using them to hide from predators, the tree serves as protection for the frogs and aren't harmed in the process (commensalism).

Two fish protecting each other from predators aren't harming each other in any way, rather they are protecting each other from another animal that wants to eat them (mutualism).

The worms however are harming the mammals because they are consuming the mammals blood, this is parasitism since one animal is benefiting and the other is harmed.

Hope this helps! :)

8 0
3 years ago
Other questions:
  • A student has to perform an experiment on the effect of heat on a particular chemical which can be seen in the form of a color c
    15·2 answers
  • On the Galapagos islands Darwin observed tortoises with a dome and saddle shaped shells. How did Darwin observation of these tor
    7·1 answer
  • How do tough waxy cuticles on leaves prevent infection?
    15·2 answers
  • Which stage is the dominant stage in gymnosperms?
    14·2 answers
  • Describe the key steps in the semiconservative replication of DNA.
    6·1 answer
  • Plant cells use specific organelles for photosynthesis in order to produce glucose. Plant cells contain another organelle that f
    13·2 answers
  • How does corona machine work???
    11·1 answer
  • Which is not an example of matter and energy cycling through living things
    11·2 answers
  • What is the total amount of protein, in grams, Morgan will get after 7 weeks of eating the same food items for breakfast and lun
    15·2 answers
  • I need help woth this question
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!