1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
4 years ago
14

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

mRNA of the above (Question 2) transcription.
Biology
1 answer:
Ierofanga [76]4 years ago
6 0
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
You might be interested in
A bird catches and tries to eat a caterpillar. The caterpillar has a bad taste, so the bird lets the caterpillar go. The next ti
NNADVOKAT [17]

Answer:

The correct option is trial and error learned behavior

Explanation:

A trial and error learned behavior is a type of behavior in which an organism attempts to or tries something new which makes it (the organism) accept the reality of that thing or situation. This means that if the attempt is successful or pleasurable, the organism will attempt it again and if it's not, the organism will avoid that thing.

This is what was described in the question with the bird trying to eat the caterpillar but found it unpleasurable which made it to start avoiding it afterwards.

4 0
3 years ago
Read 2 more answers
What’s the answer can someone pleaseeeee helpppp!!!!!!!!!!I’ll mark the brainliest
torisob [31]

Answer:

b an adaptation :)

5 0
3 years ago
Read 2 more answers
Which of the following can be used to cut DNA so it can be studied?
irga5000 [103]
Answer is A. restriction enzyme 
In biology ,Restriction enzyme is known as a scissor.
5 0
3 years ago
Read 2 more answers
How could you determine the identity of a bacterium?
cestrela7 [59]

Answer:

THE RELATIONSHIP OF IDENTIFICATION TO BACTERIAL CLASSIFICATION AND NOMENCLATURE. In order to identify an unknown bacterial isolate, the characteristics of the isolate must be compared to known taxa. In microbiology, the basic taxonomic unit is the species, and groups of related species are placed in the same genus.

5 0
3 years ago
This is made from weakened virus particles, that cause the body to build up a defense before you get an infection.
dmitriy555 [2]

Answer:

live attenuated vaccine

Explanation:

The correct answer would be a <u>live attenuated vaccine.</u>

<em>Vaccines are made from weakened/inactivated pathogens or their toxins and when they are administered to the body, they stimulate the body's immune system to produce antibodies that tend to persist and tackle any future invasion of the body by the pathogen.</em>

Vaccines can be an inactivated ones if they are made from inactivated pathogens, <u>they can be live attenuated if they are made from a weakened or attenuated version of the pathogen</u>, or toxoid vaccine if they are made from toxins of the pathogen. Other forms of vaccines include mRNA vaccines, conjugate vaccines, and viral vector vaccines.

5 0
3 years ago
Other questions:
  • What does uplift and exposure have to do with the rock cycle?
    14·1 answer
  • A human skin cell contains 46 chromosomes.A frog sperm cell contains 12 chromosomes.which pair of number shows the chromosomes n
    12·1 answer
  • Will give BRAINLEST! The picture below shows a duck that appears to have it's body detached when viewed underwater. Why does the
    6·2 answers
  • The rate at which molecules water and oxygen can enter a cell is determined by the-
    7·1 answer
  • Which gland of the endocrine system is located near the stomach and is responsible for producing enzymes and hormones that help
    5·2 answers
  • identify a major advantage and a major disadvantage of using reusable energy sources to produce electricity
    9·1 answer
  • Which of the following statements are true about
    12·2 answers
  • So your teacher tells you to go to your backyard and tell her about the ecosystem, and population, if you have dogs is that a po
    7·1 answer
  • Red flower being crossed with a white flower and creating a pink flower is an example of what
    9·1 answer
  • Which of the following would you expect to see in a positive feedback system?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!