1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
6

Fossilized stromatolites

Biology
1 answer:
Cerrena [4.2K]3 years ago
6 0

Answer:

(B) resemble structures formed by bacterial communities that are found today in some shallow marine bays.

Explanation:

Extant stromatolites represent real "living fossils" for they are decendents of ancient forms that are associated with one of the first living forms on earth. Particularly, stromatolites are real bacteria communities where the autotrophic organism of the community are represented by cyanobacteria, which live along with heterotrophic bacteria. This clearly indicates that fossilized stromatolites points to bacteria (prokaryotes) as the first living things on earth (dated with not less than 3.5 billion year old)

Nowadays, stromatolites with cyanobacteria allows to reconstruct and understand fossilized forms. These current structures live in shallow marines ambients (e.g. Australia) but also in continental salt flats (e.g. Argentina) where few others bacteria can survive to these extreme conditions (high light exposure and salt concentration).

You might be interested in
How do some economists refer to natural resources?
Dmitriy789 [7]
The Answer is All of the above
7 0
3 years ago
What is the force of resistance acting between objects in contact and tending to dampen their motion?
Zanzabum

Answer: 3.friction

Explanation: friction is a force of resistance acting between objects in contact and tending to dampen their motion

8 0
3 years ago
Read 2 more answers
If water were a nonpolar molecule, how would the properties of water be different?
krok68 [10]

Answer:

Water would not be able to form hydrogen bonds.

Explanation:

4 0
3 years ago
The ad populum fallacy occurs when
Alex
Is a fallacy that consists of a false appeal to the authority of "everyone"; based on the assumption that a course of action should be taken or an idea should be supported because "everyone" is doing it or believes it.
8 0
2 years ago
Common ancestors only exist within a single species.
puteri [66]

<u>Answer:</u>

<em>It is not true to say that common ancestors occurs only within a single species rather two species with similar traits might have a common ancestor. </em>

<u>Explanation:</u>

If the ancestor is same for both the species then it is said that both the species are closely related and share common ancestor with similar evolutionary relationship.

Phylogenetic tree are drawn and studies are done to understand the ancestor of a species. The evolution has occurred from the ancestor to the new species formed.

6 0
3 years ago
Other questions:
  • A woman is told her weight has a standard score (z-score) of –1.5. this means that
    11·1 answer
  • Which of the following adaptations does not help an animal move through the water
    7·1 answer
  • What form of reproduction is shown
    10·1 answer
  • When a person becomes an adult most cells continue to divide for what two reasons?
    15·1 answer
  • Describe one example of poaching that is prevalent in your area (EXCEPT RHINO POACHING)
    12·1 answer
  • Which is true about the light and heat apex
    12·1 answer
  • On a farm, there has been a sudden spike in the rodent population, causing an increase in crop damage and, as a result, loss of
    10·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • PLEASE HELP!!! 57. One strand of a DNA double helix has the base sequence ACGTAATCGCCG. What would be the
    11·1 answer
  • Pointing towards a man, a woman said, his mother is the only daughter of my mother. How is the woman related to the man?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!