1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
6

Fossilized stromatolites

Biology
1 answer:
Cerrena [4.2K]3 years ago
6 0

Answer:

(B) resemble structures formed by bacterial communities that are found today in some shallow marine bays.

Explanation:

Extant stromatolites represent real "living fossils" for they are decendents of ancient forms that are associated with one of the first living forms on earth. Particularly, stromatolites are real bacteria communities where the autotrophic organism of the community are represented by cyanobacteria, which live along with heterotrophic bacteria. This clearly indicates that fossilized stromatolites points to bacteria (prokaryotes) as the first living things on earth (dated with not less than 3.5 billion year old)

Nowadays, stromatolites with cyanobacteria allows to reconstruct and understand fossilized forms. These current structures live in shallow marines ambients (e.g. Australia) but also in continental salt flats (e.g. Argentina) where few others bacteria can survive to these extreme conditions (high light exposure and salt concentration).

You might be interested in
HELP ITS DUE RIGHT NOW PLEASE !!!
igor_vitrenko [27]
I think it’s a. I am not 100% sure but I think that’s what it is. I am very sorry if it’s incorrect
5 0
3 years ago
Some members of Daphnia, a water flea, have a genetic mutation that causes them to prefer warmer environments. These members rep
algol [13]

Answer:

A. Adaptation

Explanation:

Adaptation refers to the evolutionary process in which organisms undergo mutation or genetic change over many generations, which makes the organisms become better suited to multiply and survive in its habitat. The genetic mutation of Daphnia which makes them develop a trait that makes subsequent generations to prefer warmer environments is an example of adaptation of the organism to his environment.

7 0
3 years ago
Answer the following questions.
natima [27]

Answer:

Gravity?

Explanation:

These are the things needed for life: water, air, food, light, shelter, and space. It doesn't include gravity.

3 0
3 years ago
Read 2 more answers
Mercury pollution in a local lake can be traced directly to a factory located near the lake's shore. What type of pollution is t
olga2289 [7]
It would be Primary because the lake is it’s starting point and the pollution grew all the way to the factory.
3 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Other questions:
  • Sandy is a vegan and is at risk of failing to meet her daily iron needs. what would be a good food for her to eat to obtain iron
    6·2 answers
  • Why would a fish that lives in the bathypelagic zone lack a swim bladder and what adaptations would help in maintain neutral bou
    8·1 answer
  • How do aquatic organisms return carbon dioxide? (Photosynthesis, evaporation, or excretion?)
    5·1 answer
  • What is biomass?
    6·2 answers
  • A nurse recognizes improvement in a client with the nursing diagnosis of ineffective role performance related to the need to per
    12·1 answer
  • Which conclusion may be made when comparing fossils in undisturbed strata of sedimentary rock?
    14·1 answer
  • Why is still water an ideal environment for the formation of mold and cast fossils?
    10·2 answers
  • Which two of these characteristics does an organism with bilateral symmetry possess?
    11·2 answers
  • Pyruvate dehydrogenase deficiency is a genetic disease most commonly linked to a mutation in the a -subunit of the mitochondrial
    13·1 answer
  • The hormone(s) synthesized in the meristematic tissue of the plant shoot and root is/ are
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!