1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
3 years ago
7

Ppppppppppppppplllllllllllllllllllllllzzzzzzzzzzzzzzzzzz hhhhhhhhhhhhhhhhhheeeeeeeeeellllllllllllllllppppppppppp

Geography
2 answers:
Crank3 years ago
4 0

Answer:

a. human geography

Explanation:

he is studying how people move

goldfiish [28.3K]3 years ago
4 0

Answer:

<h3><em>I think its human geography PS hoped it helped :)</em></h3>

Explanation:

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What is the country that is made up of thousands of islands near the equator?
tekilochka [14]
A. Indonesia.

 the Federated States of Micronesia and the Indonesia (both of which consist of thousands of islands). Others consist of a single island, such as Nauru, or part of an island, such as Haiti. 
8 0
3 years ago
The Colossal Computer Corporation (CCC) is scheduled to open its headquarters in the city of Somewhere, USA, bringing more than
liubo4ka [24]

Answer:

Additional housing will be needed, More schools will open, More roads will be built.

Explanation:

3 0
3 years ago
In what three industries does New Zealand benefit economically because of its geography? film industry forests oil tourism coppe
stiv31 [10]
Oil tourism should be tha right one because there famous for the oil
7 0
3 years ago
Read 2 more answers
Which Group thought that the colonists were out of currently represented in parliament
Tpy6a [65]
What do you mean by that

3 0
3 years ago
Other questions:
  • Which of the following is the primary cause of change in regional metamorphism? pressure
    12·1 answer
  • The study of the anatomy of an organism<br> to explain evolutionary similarity?
    13·1 answer
  • Should we use fossil fuels for energy
    6·2 answers
  • What is the essential feature of data stored by geographical information systems?
    6·1 answer
  • Just do number 3 please and thank you
    15·2 answers
  • What causes the change in seasons? A. the dates of the equinox and solstice B. the time of the zenith C. Earth's tilt and distan
    7·1 answer
  • Do ponto de vista como os indigenas seria posssivel falar em descobrimento do brasil
    14·1 answer
  • The Vaiont Dam area was vulnerable to mass movement because (Choose one):
    14·1 answer
  • Cornelius sees a landform with almost vertical layers of sedimentary rocks. Which of the following statements is most likely tru
    7·1 answer
  • If a sediment/rock is very porous, is it also very permeable?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!