1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11Alexandr11 [23.1K]
3 years ago
8

Which factor would affect photosynthesis the least? amount of carbon dioxide in the air nitrates in the soil amount of light ava

ilability of water in the soil?
Biology
1 answer:
Elenna [48]3 years ago
3 0
The factor that would least affect photosynthesis is Nitrates in the soil.
Photosynthesis is the process by which plant make their own food by utilizing energy from sunlight, water and carbon dioxide. The limiting factors that affect photosynthesis are the light intensity, carbon dioxide concentration, temperature and water. Without enough light, a plant cannot photosynthesize very quickly, even if there is plenty of water and carbon dioxide. 
You might be interested in
How will plants be affected if they cannot receive sunlight?
barxatty [35]

Answer:

The plant will die as sunlight is key to the survival and growth of a plant.

3 0
2 years ago
Read 2 more answers
Sort the different barriers into their modes of reproductive isolation. A snail with a flat disc-like shell will not be able to
Stella [2.4K]

Answer/Explanation:

Types of reproductive isolation include: temporal, ecological, mechanical, and behavioural.

A snail with a flat disc-like shell will not be able to mate with a snail having a conical shell - this is an example of mechanical isolation, where the animals are physically unable to mate due to incompatible body shapes and sizes.

The reproductive organs of male bush babies do not match with the reproductive organs of females of other bush baby species. - this is another example of mechanical isolation, as the sexual organs will physically not allow reproduction between these species

The mating call of a cricket is not recognized by a cricket of other species - this is an example of behavioural isolation, which results from incompatible mating rituals. I.e. the animals do not respond to each others mating behaviours

The signals sent by a male firefly are not recognized by the female firefly of other species. - this is also an example of behavioural isolation.

Temporal isolation is where species cannot interact because they do not have the same mating seasons or are not active at the same type of day. ?Ecological isolation occurs when two species do not come into physical contact to one another because they access different areas of the habitat. E.g. mating zones, food sources or nesting sites.

8 0
3 years ago
Read 2 more answers
What is an organelle
Basile [38]

Answer:

any of a number of organized or specialized structures within a living cell.

Explanation:

Thanks for letting me help!!

7 0
3 years ago
Read 2 more answers
Which scenario describes a relationship of parasitism? A. Oxpecker birds eat parasitic ticks off the backs of zebras B. A polar
antiseptic1488 [7]

Answi think it is d

Explanation:

6 0
3 years ago
Read 2 more answers
Part 1 - Pick one abiotic factor and change it dramatically. (Example: remove it completely or increase it A lot)
zubka84 [21]
1. Water is abioitic and is needed by every living organism Soil is abioitic and is needed by plants Trees and other plants release water vapor from their leaves (a process called transpiration) that create humidity (which in turn influences how much rain falls in an area) The climate in an area influences the special adaptations that plants and animals have. For example: warm fur coats and thick layers of fat to keep warm in cold climates, animals in dry, hot climates (desert) have large ears to release heat and cool down. Biotic factors also influence abiotic factors. Animals produce waste (go to the bathroom) which in turn will become nutrients in the soil.
2. decrease heat will affect biotic factors, like animals, warmth.

Hope this helped :)
7 0
3 years ago
Other questions:
  • What is the lining around the brain called?
    9·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A molecule called ___________ is responsible for the rbc's ability to transport oxygen and carbon dioxide.
    14·1 answer
  • 2. Which of the following statements is true of persuasive messages?
    13·2 answers
  • What is one reason that vascular plants are larger than nonvascular plants?
    8·2 answers
  • The house fly, Musca domestica, has a haploid chromosome number of 6. How many chromatids should be present in a diploid, somati
    15·1 answer
  • Which of the following describes a relationship of predator-prey A. Oxpecker birds eat parasitic ticks off the backs of zebras B
    6·2 answers
  • NEED HELP ASAP
    8·1 answer
  • You are a community psychologist with a goal of increasing voter turnout in a community. Please identify and describe your commu
    9·1 answer
  • CER:Are viruses living thing?​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!