1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DanielleElmas [232]
2 years ago
14

An individual living entity is referred to as what

Biology
2 answers:
s344n2d4d5 [400]2 years ago
8 0
A living entity is referred to as an organism. In order of size: cell, tissue,organ,organism.
Alchen [17]2 years ago
5 0

it is an organism that is your answer

You might be interested in
In the alternation of generations life cycle the zygote undergoes mitosis to become a A. gametophyte. B. sporophyte. C. spore. D
Reil [10]
The answer you're looking for is B. Sporophyte
8 0
3 years ago
The most permeable capillaries, which contain fenestrations and large intercellular clefts, are called __________.
mote1985 [20]

Answer: Sinusoid capillaries

hope this helps!

5 0
2 years ago
Identify whether or not the different agents of evolutionary change could affect allele frequencies in a population?
igomit [66]

Yes, the different frequencies of evolutionary change could affect allele frequency in a population.

<h3>What are the agents of evolutionary change? </h3>

All populations are usual in a constant state of evolution. This means that all the species are continuously changing their genetic makeup over different generations. These changes can be subtle or they can be spontaneous.

If a population is not evolving, it is said to be in Hardy - Weinberg state. In this state, the allele frequency and the genetic makeup of the population will remain the same across generations.

The agents of evolutionary change defy the Hardy - Weinberg state. These are mutation, gene flow, non-random mating, natural selection and genetic drift.

Read more about evolutionary change, here

brainly.com/question/22172139

#SPJ4

4 0
11 months ago
Whats a sentence for biome
ludmilkaskok [199]
A biome is a large community of plants and animals that is in a area with a distinct region. There are 5 major types of biomes worldwide. These are aquatic, desert, forest, grassland, and tundra. Hope this answers the question. Have a nice day.
5 0
3 years ago
Read 2 more answers
How do white blood cells prevent bacteria on the glass from infecting her blood?
valentinak56 [21]
Dhfhddrgrgdr srg sgs s rg sg gs
5 0
3 years ago
Other questions:
  • Speech when a doctor listens to a patient's symptoms, analyzes blood tests and is then able to provide a diagnosis, the doctor h
    9·1 answer
  • Where does most seismic activity occur?
    9·2 answers
  • The cell membrane forms a protective barrier between the external and internal environments. It is referred to as ______________
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what? A
    6·2 answers
  • Why is the area of Colorado referred to as the "Red Zone"?
    13·1 answer
  • 0.75 km expressed in cm 7,500 cm 750 cm 75,000 cm 7.5 cm
    10·1 answer
  • Which of these is a ball and stick model?​
    6·2 answers
  • The giant african land snail is an invasive species that is also the largest snail ons earth what is most likely consequence of
    6·1 answer
  • How can changing the temperature of water negatively affect the environment?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!