would be the answer to this question. Behavioral Adaptation means a specific object helps the host body. Which would be C. A cactus needs that water survive.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
A
Explanation:
Options B,C, and D wouldn't work because they include multi-cellular organisms. These organisms are fungi, plants, and animals that have billions of cells within them. Thus, the most probable answer would be A since many bacteria are single celled.
Hope this helped :)
A.
Let's break it down:
-If the study has been conducted by multiple others and they get different results, it might be a sign that something went wrong in the experiment, and the data is unreliable. For example, if everybody else timed an event and got the same exact time except for the fact that you got a different time, you may start to suspect that you had done something wrong and the data was unusable.
<em>Hope this helped! :)</em>
Population of older female elephants different from the younger female elephants is described below.
Explanation:
- THE OLDEST ELEPHANTS wandering Mozambique’s Gorongosa National Park bear the indelible markings of the civil war that gripped the country for 15 years: Many are tuskless. They’re the lone survivors of a conflict that killed about 90 percent of these beleaguered animals, slaughtered for ivory to finance weapons and for meat to feed the fighters.
-
Hunting gave elephants that didn’t grow tusks a biological advantage in Gorongosa. Recent figures suggest that about a third of younger females—the generation born after the war ended in 1992—never developed tusks. Normally, tusklessness would occur only in about 2 to 4 percent of female African elephants.
- New, as yet unpublished, research she’s compiled indicates that of the 200 known adult females, 51 percent of those that survived the war—animals 25 years or older—are tuskless. And 32 percent of the female elephants born since the war are tuskless.
- A male elephant’s tusks are bigger and heavier than those of a female of the same age, says Poole, who serves as scientific director of a nonprofit called ElephantVoices. “But once there’s been heavy poaching pressure on a population, then the poachers start to focus on the older females as well,” she explains. “Over time, with the older age population, you start to get this really higher proportion of tuskless females.”
- “The prevalence of tusklessness in Addo is truly remarkable and underscores the fact that high levels of poaching pressure can do more than just remove individuals from a population,” says Ryan Long, a behavioral ecologist at the University of Idaho and a National Geographic Explorer. The “consequences of such dramatic changes in elephant populations are only just beginning to be explored.”
