1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Butoxors [25]
3 years ago
8

Shell orientation in snails is due to a maternal effect gene. A true breeding sinistral (recessive) is crossed to a true breedin

g Dextral (dominant). The offspring from that cross are self-crossed. What will be the expected ratio of shell types?
A. All sinistral
B. All Dextral
C. Half sinistral, half Dextral
D. 3/4 Dextral, 1/4 sinistral
E. 3/4 sinistral, 1/4 Dextral
Biology
1 answer:
timofeeve [1]3 years ago
3 0
Sinistral and dextral are the two types of relative direction.

If the opening is on the left then the shell (Limnaea peregra) is left-handed, or 'sinistral'.

In most snails, shells are dextral .

dextral : on the right side or the right hand.

One of the classical examples of detailed relationship between maternal genotype and egg cytoplasm “phenotype” was studied in snails .

Looking into the opening of the shell it can be seen that in one strain the shell always coils to the left (sinistral) whereas in the other shell always coils to the right (dextral).

In the cross dextral (female) x sinistral (male) all the F, progeny have dextial coils that implies dextral is dominant over sinistral. However, in the F1 x F1 cross (i.e., inbreeding) all the F1 snails are also dextral. The reciprocal cross ( dextral (female)x sinistral (male)) produces F1 progeny that are all left coiler. In this case F1 x F1 cross also yields only dextral coils.

it is clear that coiling of snails is not determined by individuals own genes but by those of mother. The coiling is phenotype in the offspring is controlled by the genotype of the mother.

In simple words ,

when dextral female is crossed to a sinistral male : the result will be all dextral.

when sinistral female is crossed to a dextral male :the result will be all sinistral.
You might be interested in
A collegiate softball outfielder tells you that she is having trouble throwing balls to the infield after catching them. The coa
Snowcat [4.5K]

Answer:

1. What modes of exercise are appropriate for this athlete?

Plyometric activity, based on a quick transition from eccentric to concentric muscle actions will help recover the power that the quadriceps are able to produce, increasing the rate of force production.

the athlete should complete weightlifting movements to overloading and improve the stretch-shortening cycle (SSC) to build impulse amplitude per step of the sprint.

2. What tests should be performed to determine the athlete's readiness for upper body plyometrics?

Successfully performing five clap push-ups in a row will be necessary to check readiness for upper body plyometric training. Upper and lower body resistance training can also be used.

3. Describe all appropriate design variables and provide the rationale for the choices.

Intensity should be gradual from low to medium-high (gradually from a 2-pound [~1 kg] medicine ball throw to a 6-pound [~3 kg] medicine ball throw);

It should be done at least two times per week; four weeks

4. What resistance training exercises may assist the athlete in reaching her goal?

Rest time in between exercises should be on a five to one work time ratio (i.e., 5:1 rest-to-work ratio).

7 0
3 years ago
Two frog populations (same species) living in two neighboring lakes sing slightly different courtship songs. Increased irrigatio
dedylja [7]

Answer:

C. The songs will become more similar to each other.

Explanation:

To answer this question, first, you need to remember that both populations belong to the same species, so they can mate because there is no reproductive barrier. The only limiting physical factor impeding individuals of both groups to cross was the piece of land before the land got wetter. So once populations got together, individuals can easily mate.

One population´s males exhibit a courtship song that slightly differs from the one of the other group. This difference has a genetic basis. But females hardly notice the difference. All of them prefer loud frogs to quieter frogs, independently of the population to which they belong.

So when the two populations get together, individuals get mixed. Females do not recognize males of their group, and during the breeding season, all females will mate the most with louder males of any of the population. So females from population A might mate with males from population B, and females from population B might mate with males from population A. So after mating season, there is also a genetic mixture between populations.

The new generations will carry elements of both genotypes. So males´ songs will be even more similar to each other. Songs will become more similar to each other because individuals of both populations are mixed and mated, and their genes intercrossed, producing new individuals with genes of both populations.

8 0
3 years ago
Water is being added to split sucrose apart into 2 simple sugars. What is the name for this process?
vampirchik [111]

Answer:

2 and 3 mate

Explanation:

hope it helps mark me as the brainliest

8 0
3 years ago
Read 2 more answers
What is a hard and tough rock that contains large crystals
frozen [14]
I think the answer is Quartz
5 0
3 years ago
A man with Type B blood has children with a woman with type A blood. Their children have the following blood types, A, AB, B, an
vladimir2022 [97]

the child has the blood type of Ab its obvious

3 0
3 years ago
Read 2 more answers
Other questions:
  • True or False A parasite having no intermediate host is liverfluke.
    11·1 answer
  • The amount of carbon dioxide in the atmosphere would greatly increase if there were fewer _____.
    6·1 answer
  • Describe the significance of the secondary and tertiary structures of a protein
    10·1 answer
  • Which part of the respiratory system is correctly paired with its function? Alveoli contract and relax to fill and empty the lun
    8·2 answers
  • The __________ are an important part of the kidney's urine-concentrating mechanism found surrounding the nephron loops (loops of
    7·1 answer
  • Which principle states that during hamate formation genes for different traits separate whiteout influencing each other’s inheri
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Understand the process of base pairing in both DNA and RNA.
    6·1 answer
  • Which owl was most fit?
    6·1 answer
  • HELP ME PLEASE SOMEONE HELP
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!