1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonja [21]
4 years ago
13

Which of the following organisms are photosynthetic autotrophs? Select all that apply.

Biology
2 answers:
katrin2010 [14]4 years ago
8 0
<span>Photosynthetic autotrophs include the green plants, algae and some bacteria. 
Your answer is A,B, D</span>
Novosadov [1.4K]4 years ago
6 0

(A)Algae

(B)Plants

(D)Some Bacteria

You might be interested in
PLZ HELP ME
ikadub [295]

Answer:

<em>The correct option is C) 1,2 and 3</em>

Explanation:

Sodium- Potassium pump: Sodium- potassium pump uses ATP to move sodium and potassium ions in opposite directions against the concentration gradient. In one pump, three sodium ions move outside the cell whereas two potassium ions move inside the cell.

Exocytosis: Exocytosis can be described as a form of active transport in which  molecules move out of a cell.

Endocytosis: Endocytosis can be described as a process which utilizes ATP to transport molecules inside a cell.

5 0
3 years ago
How does the Department of Environmental Protection try to prevent water breaks from happening? Answer
loris [4]

Answer:

water mains break. And when they do, they disrupt the lives of those serviced by them. Breaks can close down roads, cause damage to property and generally wreak havoc on the area around it. So why does it happen? This simple guide can help explain it to your customers.

Explanation:

Pa like, Pa rate, At pa follow thanks ❤️

7 0
3 years ago
The disappearance of many species during a relatively short time is known as
Sonbull [250]
The disapperance of many species during a relatively short time is known as extinction
7 0
3 years ago
Read 2 more answers
When is it necessary for a scientists to do research? Select all that apply. before forming a hypothesis only after a hypothesis
Marysya12 [62]
Because a hypothesis is different from the research question, research is usually required before you make a hypothesis. A hypothesis is a prediction of the test that is about to incur. Without the research the people doing the test would not know what to be looking for or how to setup the test. Because of the reason;

I assume the answer is, after generating an idea from an observation.
5 0
3 years ago
Read 2 more answers
1. Which of these statements can be
stich3 [128]
A)A chromosome is a long continuous strand of DNA
4 0
3 years ago
Other questions:
  • Compare asexual reproduction and sexual reproduction in terms of the genetic diversity resulting from each.
    6·1 answer
  • D) A student suggested that purple flowers are more likely to be visited by bees than white flowers.
    10·1 answer
  • How has technology changed farming
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • A population of white moths lives in a forest near a factory. This factory burns coal and pollutes the air with black dust. Over
    5·1 answer
  • Question 4
    10·1 answer
  • Why do the cells need to divide
    7·1 answer
  • Please help me to do this thank you
    11·1 answer
  • How many food chains are in this food web?
    6·1 answer
  • Where might a spring form?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!