1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
2 years ago
10

Description of change 2011 japan tsunami

Biology
2 answers:
makvit [3.9K]2 years ago
8 0
Their economy dont grow and most of the people have to go to the military.

Vinvika [58]2 years ago
4 0
2011 Tōhoku earthquake and tsunami<span>The 2011 earthquake off the Pacific coast of Tōhoku was a magnitude 9.0–9.1 undersea megathrust earthquake off the coast of Japan that occurred at 14:46 JST on Friday 11 March 2011, with the epicentre approximately 70 kilometres east of the Oshika Peninsula of Tōhoku and the hypocenter at an underwater depth of approximately 29 km. The earthquake is also often referred to in Japan as the Great East Japan earthquake and also known as the 2011 Tōhoku earthquake, and the 3.11 earthquake. It was the most powerful earthquake ever recorded to have hit Japan, and the fourth most powerful earthquake in the world since modern record-keeping began in 1900. The earthquake triggered powerful tsunami waves that reached heights of up to 40.5 meters. got from Wikipedia, need anything else let me know</span>
You might be interested in
Describe what happens to pyruvic acid under aerobic conditions​
lbvjy [14]

Answer:

Explanation:

The pyruvic acid is oxidised to CO₂, ATP, and NADH₂ and FADH₂

5 0
2 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
which Statement correctly describes why cells are so small? a) when cells are small the movement of food and waste can be effici
igomit [66]

Answer:

a) when cells are small the movement of food and waste can be efficiently handled by the cell membrane

Explanation:

Cells need to get their nutrients and waste in and out of their cell membrane every quickly. Cells are hard workers anyway! The other options also don't make much sense. The cell shape doesn't mean much to their function, and size doesn't impact shape. The cell's internal parts (mitochondria, vacuole, etc) don't support the cell membrane, they have their own functions to focus on. Cells don't work together in tissue but they can interact with each other when needed.

8 0
2 years ago
Read 2 more answers
What process allows water to enter the atmosphere?
iren [92.7K]
Heat from the Sun causes water<span> to evaporate from the surface of lakes and oceans. This turns the liquid </span>water<span> into</span>water<span> vapor in the </span>atmosphere<span>. Plants, too, help </span>water<span> get into the </span>atmosphere<span> through a </span>process<span> called transpiration</span>
8 0
3 years ago
True or False: It's normal for climates to change naturally over time.
zavuch27 [327]
True I hope this helps you with your test
4 0
3 years ago
Read 2 more answers
Other questions:
  • What waste product of photosynthesis allows you to live on earth?
    12·2 answers
  • What energy is used during the process of photosynthesis
    15·2 answers
  • Which is not an example of a "living" life process?
    6·2 answers
  • The barn owl is nocturnal. Describe the biological rhythm of the owl and discuss how extreme alterations in the number of daylig
    9·2 answers
  • The diploid number of chromosomes in one human somatic cell is: TEST IS TIMED!! 23 pairs of chromosomes 23 pairs of alleles two
    5·1 answer
  • At what time of day would you be most likely to find that the air over water is significantly warmer than the air over land near
    7·2 answers
  • Cross a homozygous dominant individual for brown hair with an individual who is blond hair . remember the starting are the paren
    5·1 answer
  • What is one of the root causes of environmental problems?
    7·1 answer
  • Help please asap!!!!!!!!!!!!!!!!!!!
    9·1 answer
  • WILL GIVE BRAINLIEST, 50 POINTS!!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!