1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
10

Would offshore turbines be able to produce more electricity off the coast of alaska of louisiana?

Biology
1 answer:
BlackZzzverrR [31]3 years ago
3 0
The answer would be alaska
You might be interested in
Which characteristic sets streams and rivers apart?
nikdorinn [45]

size hence streams  are little and rivers are bigger than streams because a stream connects between two or more rivers

mark brainliest please   :)

3 0
3 years ago
Dominic, a newborn, received antibodies from his mother through the placenta and breast milk. Which specific type of immunity is
elena-s [515]

Answer and Explanation:

1. passive natural immunity

2.  decrease

3. passive artificial immunity

4. His body contains antibodies from his previous exposure, and his body was able to quickly fight off the infection

5. active natural immunity

6.  B cells

7.  Neutrophils

6 0
3 years ago
Choose all the answers that apply.
kondor19780726 [428]

Answer:

are tight coils of DNA

carry thousands of genes

Explanation:

6 0
3 years ago
Read 2 more answers
Which structure in the heart'separates<br> oxygenated blood from deoxygenated blood?
lisabon 2012 [21]

Answer:

pericardium

Explanation:

A double-walled membrane, the pericardium, separates the right and left chambers, preventing oxygen-rich blood from mixing up with the one without oxygen. So, the heart functions go smoothly. Deoxygenated blood enters the right atrium.

6 0
3 years ago
Genetic diversity is the variation in the genes of an entire species. Each circle represents a population of a particular specie
GarryVolchara [31]
That’d be the 2nd one from the right.

That population has the highest variety of organisms(individuals) compared to the other populations.
4 0
4 years ago
Read 2 more answers
Other questions:
  • How does the function of melanin explain not only the variety of skin colors but susceptibility to skin cancer?
    9·2 answers
  • Which is made up of lipids<br><br> a) steroids<br><br> b) peptides<br><br> c) prostaglandins
    11·1 answer
  • Does the gene EEF1 ALPHA1 support the cell theory
    12·1 answer
  • What joins amino acids to make proteins?
    7·2 answers
  • Most of the biomass in the ecosystem above would be found at the...
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Using the genetic code, which of these events can happen?
    7·1 answer
  • Snow is a form of what
    8·1 answer
  • Question 21<br> Neurons of the cerebral cortex never dip into the medulla.<br> O True<br> O False
    15·1 answer
  • Compare the gravitational pull of the earth to that of the moon, the planets, and the sun.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!