1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
3 years ago
14

Tumor radiosensitivity is increased by the presence of

Biology
1 answer:
tekilochka [14]3 years ago
5 0
Became a cancer cells infection
You might be interested in
An image that shows light from a light bulb reflecting off aluminum foil all of the light is being reflected do you think that a
zysi [14]
Yes because just how the use lights to keep food warm a fast food places and such I have also used this in science to heat up pizza
4 0
3 years ago
According to the NASM Code of Professional Conduct, a Certified Personal Trainer shall maintain accurate financial, contract app
jeyben [28]

Answer:

D. Four years

5 0
3 years ago
If Jennifer is studying the functional relationship between the heart, arteries, veins and blood, then she is studying anatomy a
Alborosie
The correct answer is organ system level of organization.
5 0
2 years ago
The blue substance, DMSO molecules, is a muscle relaxer used by athletes to soothe cramps. Unlike most substances, it can pass d
34kurt
Well A osmosis is the movement of water so it isn't that answer
B diffusion may be the DMSO can diffuse into the cells directly
C phagocytosis only applies to phagocytes destroying pathogens
D active transport for this the cells have to use ATP to bring the DMSO across a concentration gradient

So I think the answer is B the DMSO moves from the blue substance into the cells directly.

hope that helps
8 0
4 years ago
True or False? The final step of manually reconciling a bank statement is comparing deposits noted on the statement against the
MrRa [10]

Answer:

true

Explanation:

hope it helps.....

6 0
3 years ago
Read 2 more answers
Other questions:
  • Agricultural scientists are trying a new man-made vitamin on tomato plants to make them bigger and redder. They are putting the
    5·1 answer
  • How is the skeleton similar to the frame of a house?
    12·2 answers
  • A tumor that spreads from its original location to another location is called _____.
    6·2 answers
  • Like poisonous dart frogs, monarch butterflies are brightly colored. What might be adaptive advantage of bright coloration?
    11·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Classifying an organism as a protosome or a deuterosome is based on whether the _____________.
    6·1 answer
  • What did Darwin's studies of Vestigial Organs and Atavisms tell him about the process of evolution? : a.The appearance of such s
    6·1 answer
  • How would the solute potential of agricultural soil change from morning to the middle of the afternoon on a hot dry summer day?
    15·1 answer
  • We get energy from the food we eat. The energy in the food first comes from?
    7·1 answer
  • Which substance is a product of photosynthesis? O A. Nitrogen O B. Glucose O C. Carbon dioxide O D. Water​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!