1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DiKsa [7]
3 years ago
14

An article about the digestive system ​

Biology
1 answer:
tensa zangetsu [6.8K]3 years ago
4 0

answer: please refer to my word document which i wrote and attached in my answer.i hope it helps you i am so sorry if it wasnt what you wanted. PLEASE DOWNLOAD MY DOCUMENT AND OPEN IT YOU WILL FIND MY WORK .I ALSO ADDED A DIAGRAM OF THE DIGESTIVE SYSTEM TO HELP YOU UNDERSTAND MORE.

HOPE IT HELPS U!

Download docx
<span class="sg-text sg-text--link sg-text--bold sg-text--link-disabled sg-text--blue-dark"> docx </span>
38b46dd4addfe4b2bebc0d50aa1d5a0f.jpg
You might be interested in
What is the difference between aerobic and anaerobic respiration?
valentina_108 [34]
Anaerobic respiration<span> is in muscles. Glucose is not completely broken down, so much less energy is released than during </span>aerobic respiration<span>. There is a build-up of lactic acid in the muscles during vigorous exercise. The lactic acid needs to be oxidised to carbon dioxide and water later.</span>
3 0
3 years ago
A client has been prescribed librax (chlordiazepoxide + clidinium), an anticholinergic benzodiazepine for irritable bowel syndro
spin [16.1K]
Librax is a medicine which is composed by:
- Chlordiazepoxide: it's a benzodiazepine. All benzodiazepine should never be taken with other drugs because it will major its effects. a person with <span>a history of substance abuse should not take Librax.
- Clidinium: It's a drug with anticholinergic effects, they are known for being avoided in persons with prostate hyperplasia because it will cause </span>urinary retention<span> and glaucoma due to its mydriasis effect.</span>
8 0
3 years ago
The bridge in the picture is connecting two pieces of land that represents two distinct places. What type of boundary is this?
vodka [1.7K]

Answer:

The correct answer is - divergent.

Explanation:

A divergent plate boundary is plate boundary that is form by the sepration of the two distinct tectonic plates away from one another and result in the forming the ranges known as oceanic spreading ridges.

This type of plate boundary occurs due to the earthquack or volcanic erruption of from the mantle to surface of the earth. This magma or rises and forms oceanic crust by the solidifying of the moleten rocks.

3 0
3 years ago
Read 2 more answers
Explain biotic components of wetland ecosystem
Lostsunrise [7]
Plants, animals, microbes, and all other living organisms make up the biotic aspects of wetlands. Amphibians (particularly in wetlands), reptiles, birds, insects, and mammals are examples of animals. Mangrove, water lilies, cattails, sedges, tamarack, black spruce, cypress, and gum plants are examples of plants.
5 0
2 years ago
How can what you see can impact other human body systems?
anyanavicka [17]
What we see can send panic signals to our endocrine system and then have an effect on systems from there. and also if we see something we are scared of it can stop our breathing, make us scream, close our eyes and other things.
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

5 0
3 years ago
Other questions:
  • A volleyball player has come into the training room after falling on an outstretched arm at practice and hyperextending her elbo
    6·1 answer
  • Red blood cell will swell and burst when placed in which of the following kinds of solution
    8·1 answer
  • In a nuclear reactor, when the control rods are lowered between the fuel rods, they ______ the reaction
    8·1 answer
  • The method of irrigation that evaporates the most water because it is sprayed in small droplets is ______.
    10·1 answer
  • Why would DNA need to replicate ? Two reasons
    6·1 answer
  • Which of the following is a secondary color?<br> A. blue <br> B. orange <br> C. red <br> D. yellow
    11·1 answer
  • Supuie ) Prokaryotes have nucleus that is without : i) nuclear ii) membrane nucleous iii) nucle​
    6·2 answers
  • Prokaryotes include one of the following:
    7·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Survival on land for organisms is difficult because of the problem of.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!