1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
4 years ago
5

The __________ lobe contains the primary sensory cortex, which controls sensations such as touch or pressure

Biology
1 answer:
Mama L [17]4 years ago
7 0
The parietal lobe contains the primary sensory cortex, which controls sensations such as touch or pressure.
You might be interested in
How do you think scientists count the world’s human population?
ArbitrLikvidat [17]

Answer:

Scientist count the world humans population with an organization called The United Nations Population Division (UNPD),

Explanation:

Which keeps track of the world population, projects that the world's human population will hit 7 billion on Halloween Day 2011. Admittedly, that is just an estimate: There's no way to know exactly how many people are alive at any given moment, and the true date that humanity's ranks will surpass 7 billion could come in the weeks or months before or after Oct. 31. Nonetheless, the UN's guess is the best there is.

4 0
4 years ago
Plz answer ASAP
natulia [17]
Casein wrappers// basically made out of a milk fiber, i’m pretty sure it’s edible
8 0
3 years ago
Im Wich organ in the lymphatic system does the breakdown of damaged red blood cells take place
Alexxandr [17]

The angle bisector theorem is commonly used when the angle bisectors and side lengths are known. It can be used in a calculation or in a proof. An immediate consequence of the theorem is that the angle bisector of the vertex angle of an isosceles triangle will also bisect the opposite side.


4 0
3 years ago
the guard cells take in minerals by active uptake from the cells next to them. Explain why water then passes into the guard cell
Step2247 [10]
When guard cells lose potassium ions, water diffuses out of the cells by osmosis. As water leaves the cells, they become flaccid and less bowed, which closes the stomata between them.
6 0
3 years ago
What is the largest natural population of organisms that can interbreed to produce fertile offspring? A) Class B) Family C) Genu
RUDIKE [14]
D speicies is the correct answer
7 0
4 years ago
Read 2 more answers
Other questions:
  • How many different allele combinations would be found in the gametes produced by a pea plant whose genotype was RrYY? (1 point)
    13·1 answer
  • How is a terrarium similar to a natural ecosystem? how is it different?
    10·1 answer
  • The widespread loss of wetlands would have little effect on the overall health of the environment.
    8·2 answers
  • What is fishery, and mention two classes of fish based on their habitat​
    14·1 answer
  • What is the meaning of the term abscission?
    12·1 answer
  • What's the new peptide chain when the new DNA segment is translated?
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • During embryo screening, a technician tests the genetic material of the embryo to find out which alleles are present.
    14·1 answer
  • The leg muscles of a sprinter would differ from a marathon runner in that ________. The leg muscles of a sprinter would differ f
    6·1 answer
  • PLEASE HELP! WILL MARK BRANLIEST!<br><br> Fill in the correct answers in the boxes below.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!