1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
4 years ago
5

Select the three basic ways in which microbes cause tissue damage.

Biology
2 answers:
AfilCa [17]4 years ago
7 0

<em>Some microbial ways to cause tissue damage, as follows : </em>

1. Exotoxins produced by microbes can cause host cells to damage, this is done by microbes by disrupting normal cell metabolism which can cause fatal damage to cells.

2. Exotoxins released by microbes can be spread in several environments during the growth phase of pathogenic bacteria. Several environments can cause exotoxins to cause disease, including the following:

- The first environment is, exotoxins are released in food, which can cause humans to be attacked by foodborne diseases.

- The second environment, that is, exotoxins develops on the surface of mucosal cells that invade host cells to attack weak tissue.

- The third environment, namely, pathogenic bacteria that come out of the abscess and produce exotoxins. This can accelerate the growth of bacteria.

<h2>Further explanation </h2>

Microorganisms or commonly referred to as microbes are single-celled microscopic organisms such as bacteria and fungi. Although microbes are often associated with dirt and disease, most microbes are beneficial. For example, microbes maintain the cleanliness of nature by helping to break down dead plants and animals into organic matter. (<em>the study of microorganisms themselves are usually called microbiology</em>).

To be able to help in understanding various types of microbes, scientists classify in various ways. Microbes are very diverse and represent all the great kingdoms of life, including animals, plants, fungi, protists, and bacteria. In fact, in terms of numbers, most of the diversity of life on Earth is represented by microbes. The following is an outline of a group of organisms that are examples of microbes:

  • Protist
  • Mushroom
  • Plant
  • small animal
  • Prokaryotes
  • Eubacteria
  • Archaea
  • Eukaryotes

Learn more

Microorganisms brainly.com/question/9004624, brainly.com/question/6699104

Details

Class: High School

Subject: Biology

Keyword: How microbes cause damage to cells.

ANEK [815]4 years ago
5 0
Microbes cause tissue damage to their host cell or body in different ways.

1. Microbes can release toxins that can damage the cells and tissues of the host.

2. Microbes can release enzymes that can breakdown the cells and tissues of the host.

3. Microbes can activate certain responses in the host that can make the latter destroy its own tissues. Usually, the immune response of the host cell is disturbed, making the immune system attack the cells of the host itself. 
You might be interested in
Which of the following reasons best explains why a scientist would want to study rock formations and living organisms in previou
Gre4nikov [31]

The correct answer is option (A) to discover new aspects of the natural world.

The study of rock formations and living organisms in previously unexplored water habitats helps a scientist to discover the newer aspects of the natural world. The unexplored water habitats are the best source to understand the newer aspects of the aquatic bodies like the new species of plants or animals, factors affecting the aquatic life and the different types interactions in the habitats. The study of rock also helps in the study of plants and animals, which were once a part of the habitat, now in the form of fossils.

Thus, the study of rock formations cannot explain the recently observed phenomena as they help in the study of fossils. The study of living organisms in previously unexplored water habitats cannot be applied to test the conclusions of prior investigations and test the predictions of current theories as they remained unexplored.

7 0
4 years ago
Can somebody help me label this map plz!!!!
Leni [432]

Russia

magnolia

Kazakhstan

iran

Thailand

china

laos

Explanation:

if I'm wrong,

someone correct me..

8 0
3 years ago
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
PLEASE HELP ILL MARK BRAINLEST. (Melanin Unit) Part 1: First just make observations of the pedigree below. Second answer the fol
Snowcat [4.5K]

Answer:

Pedigrees are used to analyze the pattern of inheritance of a particular trait throughout a family. Pedigrees show the presence or absence of a trait as it relates to the relationship among parents, offspring, and siblings.

Explanation:

8 0
3 years ago
Efferent neurons are motor neurons carrying information out of the cns to the _______ and _______.
coldgirl [10]
Brain and other neurons
7 0
3 years ago
Other questions:
  • Water dissolves many substances. This occurs because water has what?
    7·1 answer
  • How many different types of offspring (genotypes) are possible as a result of this cross, according to the punnett square?
    7·1 answer
  • Which specialized cells are responsible for transmitting messages throughout the body
    11·1 answer
  • Which was the dominant terrestrial life form during the mesozoic era?
    13·1 answer
  • Endocytosis moves materials _____ a cell via _____.
    11·1 answer
  • If the ribosomes in a cell were rendered useless, the cell would most likely be unable to
    9·1 answer
  • How will the convection currents in the earth change the surface of the earth
    5·1 answer
  • 13. Jane wants to figure out which of two foods is the healthiest for her pet gerbil, Bob, so she decides to conduct an
    10·1 answer
  • Do you think a charger would be a good example for mitochondria?
    9·1 answer
  • The function revolves around protein synthesis
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!