<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Because whales live in the ocean, many people think they are fish. But do you know that whales and dolphins are not fish? They are mammals. People are mammals too. Mammals are the group of animals that breath air using lungs, give birth to live young (rather than laying eggs), and feed their young with mother’s milk. All animals, including people, need oxygen, a chemical found in the air and in water. Fish use their gills to take oxygen from the water that they live in. But people get the oxygen we need by breathing air, using our lungs. Whales and dolphins use their lungs to breathe air also.
That’s one reasons why they come to the surface of the ocean. Sometimes they lie right at the surface of the water, with just a part of their back sticking out. Look closely at a picture of a whale or dolphin; can you see a nose on the whale? You can’t, because whales don’t have noses like you and me. Instead they have a hole – called a “blow hole” – on top of their heads. Sometimes when a whale breathes air out of its blow hole, it shows up as a spray or mist – called a “spout” – that can be seen many miles away. Blow holes are surrounded by muscles that keep the hole closed when the whale or dolphin is under water and open it when the animal is at the surface and needs to breathe.
In fact, some of the animals have two blow holes next to each other and others have only one. So when you see a picture of a whale, see if you can tell the difference. Pilot whales and dolphins have one blow hole; humpbacks, minkes and right whales have two
Incomplete question. Here are the missing parts.
What will happen to the substances in this diagram to bring the concentrations closer to equilibrium?
A. The solute will flow into the cell from the surrounding environment.
B. Nothing will change--it is already in equilibrium.
C. Water will flow into the cell from the surrounding environment.
D. Water will flow out of the cell and into the surrounding environment.
My answer:
D. Water will flow out of the cell and into the surrounding environment.
The solute cannot pass through and go inside the cell, water has to flow from the cell to the surrounding environment to bring the concentration closer to equilibrium.
It is associated with more or less why a genetic counselor would need to look at distinct human populations, with which an individual is related to when doing certain kinds of tests. For instance, if someone knows about their ancestry then the counselor would be able to tell about the genetic disorders most commonly occurring in that particular ancestry.
The basic way of seeing at it from a population genetics point of view is how populations do differ genetically and how does it associate with the probabilities of exhibiting a mutation in the person.
Answer:
Genes are transferred from parents to offsprings by inheritance. Each offspring receive half of their genes from mother and half from father. But answer of this question is:- Each offspring receive not exactly the same halves of the genes. This different halved of the genes are the reasons we don't.
Explanation:
The only example is with step parents, or others. Half of the parental genes are passed to the child, so a chance for one to look like the uncle or aunt of the family is high. It can also look like any before them, such as a grandmother, father, great grandmother, etc.
