1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedaia [141]
3 years ago
7

Where do prions come from?

Biology
1 answer:
Musya8 [376]3 years ago
6 0

Answer:

There are prion-like particles in the brain normally, and when these become abnormal they can cause disease. (Ans. A)

Explanation:

Prions are proteins which can trigger normal proteins to fold abnormally, and they are present in the brain. They are causing many types of neurodegenerative diseases in both humans and animals. Which are known as transmissible spongiform encephalopathies.

Prions can enter the brain with the help of infection, also can arise from the gene mutation that encodes the proteins, and sometimes this affects humans by infected meat.

If a person infected from prion disease, it affects central nervous system tissues like brain, eye tissues and spinal cord.

You might be interested in
The thermosphere is the hottest layer in the atmosphere because
Naddik [55]
The ozone layer reflects the suns heat hottest layer in the atmosphere
5 0
3 years ago
Please answer this. "/
NikAS [45]

Answer:

Trough – the lowest point below the rest position. Amplitude – the maximum displacement of a point of a wave from its rest position.

5 0
2 years ago
Read 2 more answers
3. Organelles that digest waste molecules or food particules are known as
docker41 [41]

Answer:

it's answer is lysosomes

5 0
3 years ago
Read 2 more answers
How many of you would it take to light a 60 W light bulb
kolbaska11 [484]
Would the answer be one?
5 0
3 years ago
Roots that enable a plant to grow on another plant are called ________.
Luden [163]

Answer:

epiphytic roots

Explanation:

Epiphytic roots are those that live on other plants without parasitism. In this relationship, the epiphyte uses the other vegetable only as a support (phorophyte), removing no nutrients and, consequently, causing no harm to the species.

Epiphyte roots are estimated to represent about 10% of the total amount of vascular plants on the planet. This means that there are on average 29,000 plant species with this peculiar habit of life. These vegetables are mainly found in tropical rainforests and have almost no representatives in places with very low temperatures.

8 0
3 years ago
Other questions:
  • A glucose molecule is the______________ Choices: smallest type of protein. . monomer of starch and cellulose. . largest of the c
    15·2 answers
  • Need help with the biology picture
    5·1 answer
  • Compare and contrast in the illustration below, which vehicle has the greatest kinetic energy? Explain your answer.
    10·1 answer
  • What type of cell makes bone tissues
    14·1 answer
  • What do bacteria have in common with the cells of other living organisms?
    14·2 answers
  • Does anyone know how to do this cause I really need someone's help?!?
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What are limiting factors affecting the African Wild Dogs carrying capacity ?
    13·1 answer
  • Describe polarity in your own words.
    12·1 answer
  • What does the smooth endoplasmic reticulum do in an animal cell.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!