1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uranmaximum [27]
3 years ago
11

Does carrying capacity influence the survival of a population?

Biology
1 answer:
aivan3 [116]3 years ago
3 0
'<span>Does carrying capacity influence the survival of a population?'

The answer you're looking for is something along the lines of Yes, because a carrying capacity that is too small will be easy prey, while a carrying capacity that is too large will consume it's needed resources too quickly.

Hope this helped!</span>
You might be interested in
Elizabeth discovers an organism in the wild and collects a sample of cells for identification in the lab. She observes that the
BartSMP [9]

Answer:

Fungi

Explanation:

The have a cell wall and nucleus. But no chlorophyll since they are decompose stuff

4 0
2 years ago
Protein are digested and transported by fellow protein. Give vivid examples to support the statement
Nonamiya [84]

Answer and Explanation:

The transport and digestion of proteins is done by other proteins called enzymes. An example of this occurs in the biochemical digestion of proteins, where the enzyme pepsin promotes digestion, the breakdown of proteins into smaller pieces, through hydrolysis which is the breakdown of molecules with the use of water. These pieces of the protein are transported to the duodenum where they are digested again by the enzyme enterokinase.

8 0
2 years ago
Which items work to stop bleeding?
Natasha2012 [34]
Platelets stop bleeding.
4 0
3 years ago
Read 2 more answers
What percentage of the moon as seen from Earth is illuminated during the third quarter phase?
Alex73 [517]

Answer:

50% of the moon is illuminated during a third quarter phase

4 0
3 years ago
Read 2 more answers
The first organisms to grow in new or disturbed areas are called
maks197457 [2]
The first organisms to grow in new or disturb areas is called pioneer species. 
4 0
3 years ago
Other questions:
  • In most medical procedures, hazardous waste is produced. this hazardous waste is usually burned, which can release hazardous che
    9·2 answers
  • Should existing structures build from CCA-treated wood be removed?
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What distinguishes disruptive and directional selection pressures when both select for extreme genetic traits?
    11·2 answers
  • The major buffer in blood is composed of the weak acid carbonic acid (H2CO3) and its conjugate base, bicarbonate ion (HCO3 - ).
    9·1 answer
  • Kathleen is testing a mixture containing a certain substance. She takes a sample from the top and the bottom. The sample from th
    6·1 answer
  • A liquid with strong forces between the particles has a low viscosity true or false
    6·1 answer
  • genetics help: what is this person's ethnicity? Please provide facial features that made you think of that ethnic background
    12·1 answer
  • Each day your body makes (.......BLANK.....) red blood cells.
    11·1 answer
  • A molecular biologist is developing a computer model of the transcription of a gene into RNA. Which event should be included in
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!