1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
3 years ago
9

The effects of anaerobic conditions how would anaerobic conditions (when no o2 is present) affect the rate of electron transport

and atp production during oxidative phosphorylation? (note that you should not consider the effect on atp synthesis in glycolysis or the citric acid cycle.)
Biology
1 answer:
Romashka-Z-Leto [24]3 years ago
6 0
Anaerobic condition refers to an environmental condition where oxygen is absent. In case of Electron Transport System (ETS) and ATP production, oxygen acts as the final acceptor of electrons. As oxygen is a reactant in ETS and ATP production, unavailability of oxygen can cause no oxidation of the coenzymes or the carriers such as NAPH and FADH2 and no ATP will be produced. Thus, both Electron Transport System and ATP production will stop in the absence of oxygen.
You might be interested in
When glucose is broken down to co2 and h2o, __________ energy is released and converted into __________?
kogti [31]
The First Blank Is Chemical And The Last Blank Is Potential.
8 0
3 years ago
The rate of heat production is increased by increasing muscle contraction by movement is: Shivering thermogenesis Non- Shivering
vesna_86 [32]

Answer:

Shivering thermogenesis.

Explanation:

The rate of heat production is increased by increasing muscle contraction by movement is shivering thermogenesis because nerve impulses are transmitted to the skeletal muscles by the hypothalamus which will result to contractions that will produce heat.

Shivering thermogenesis is Contraction-mediated heat production High intensity shivering activates large muscles and produce more glycolysis which is then use as the main source for heat production

3 0
3 years ago
Which equation best represents the process of photosynthesis ? A. Water+ carbon dioxide (light) > sugars + oxygen B. Sugars +
densk [106]

A. Water+ carbon dioxide (light) > sugars + oxygen

4 0
3 years ago
Which substance completes passive transports and facilitated diffusion?
11111nata11111 [884]
And: Facilitated diffusion is a type of passive transport that allows substances to cross membranes with the assistance of special transport proteins. Some molecules and ions such as glucose, sodium ions, and chloride ions are unable to pass through the phospholipid bilayer of cell membranes.
8 0
3 years ago
If you can only find a particular
madam [21]

Answer:

B

Explanation:

Source credibility is very important. If there isn't any other information that proves or disproves your source or double checks it, its not typically "credible"

8 0
3 years ago
Read 2 more answers
Other questions:
  • Vein deposits are usally produced by?
    14·1 answer
  • In the image below, in which location is limestone formed?
    7·2 answers
  • How is the pyramid you drew different? why??
    6·1 answer
  • A. You are performing experiments with your protein of interest and its ligand. You are attempting to mutate the binding site of
    10·1 answer
  • What are auroras made of?
    8·1 answer
  • During electrophoresis, DNA fragments move toward the anode. What does this
    6·1 answer
  • Select all of the answers that apply.
    14·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • ILL GIVE BRANILIST PLEASE HELP
    7·1 answer
  • Explains how the atoms that make up glucose can be used to construct macromolecules
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!