1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
azamat
2 years ago
14

How does the change in temperature affect pepsin?

Biology
1 answer:
Oksana_A [137]2 years ago
4 0

Answer

When testing the effect of temperature on pepsin enzyme activity, the results showed that pepsin worked best at the temperature 30 °C. When the temperature decreased to 22 °C, the enzyme activity decreased sharply. Turbot and redfish retained almost half of the activity at low temperatures (5 °C).

You might be interested in
In the 18th century, a young boy suffered from a skin condition that included thickening of the skin and the formation of loose
PIT_PIT [208]

Answer:

THE DOMINANT GENE CAME FROM THE FATHER TO ONLY THE SONS THE RECCESIVE GENE WENT TO HIS DAUGHTERS

Explanation:

6 0
3 years ago
"New Caledonian crows consume a wide range of foods. These crows require tools to extract the larvae of wood boring beetles from
chubhunter [2.5K]
After reading the above information, one reason different members of  crow populations have a different rate of survival is there is always a chance that that some other variation will also effect some of the crows ability to survive. Another reason is  that the vision, muscle strength and size can influence survival. 
8 0
3 years ago
HELP PLEASE: The German scientist _______ noticed that the coastlines of Africa and South America looked like they might fit tog
andriy [413]

Answer: German scientist Alfred Wegener

Explanation: <em>In the early 1900s, the German scientist Alfred Wegener noticed that the coastlines of Africa and South America looked like they might fit together. He also discovered evidence that the same plant and animal fossils were found along the coasts of these continents, although they were now separated by vast oceans.</em>

7 0
2 years ago
The amount of available energy changes between the trophic levels found in a food chain or energy pyramid. Photos (left to right
Aliun [14]

Answer;

A. leaf to mouse

Explanation;

-Considering the fact that the amount of energy at each trophic level reduces as it moves through an ecosystem from the lowest trophic level which happens to be producers (plants).  And about 10 percent of this  energy at any trophic level is transferred to the next level since the rest is lost largely through metabolic processes as heat.

-It means that the lower the trophic level the higher the energy obtained, for instance from producers to primary consumers, more energy is passed since it is the first passage of energy.

8 0
3 years ago
Read 2 more answers
What is the serosa?
FinnZ [79.3K]
The correct option is A.
The serosa refers to the outermost layer of loose connective tissues which is often covered by mucus and which contains blood vessels. In the gastrol intestinal tract, the serosa refers to the outermost layer of the wall of the GI tract. One major function of serosa is to reduce friction from muscle movement. 
3 0
3 years ago
Other questions:
  • What two categories did Greek philosopher Aristotle use to classify living organisms ?
    13·2 answers
  • A rock has been formed by the accumulation of bits of rocks that were originally formed by the release of heat by magma. How sho
    10·1 answer
  • Why was ice used during the extracting DNA
    13·1 answer
  • The process of the moon beginning to illuminate from a new moon to the full moon, appearing larger, is called-------------
    13·1 answer
  • Do you think ancient Antarctica was situated in a different location from its location today? Why or why not?
    13·2 answers
  • Which process in an apple tree primarily results from cell division
    8·1 answer
  • Experiments groups are divided into two groups which are
    7·1 answer
  • Which 2 body systems work together to transport oxygen to cells?
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The endocrine system uses chemical messengers called *<br> -glycogen<br> -hormones<br> -starch
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!