1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
14

Which of those three wrote the book the double helix

Biology
1 answer:
vekshin13 years ago
8 0
James watson
please mark brainliest and thanks!!

You might be interested in
Describe laboratory tests, clinical procedures, and abbreviations related to endocrinology.
zalisa [80]

Laboratory tests and clinical procedures include:

  • The blood glucose test and the glycosylated hemoglobin test are tests to identify diabetes and prediabetes (A1c).
  • A glucose tolerance test may be administered to you if you're expecting to check for gestational diabetes.
  • Your thyroid's functionality can be determined by a number of tests, chief among them a TSH measurement.
  • Other examinations can evaluate parathyroid problems.
  • Female hormonal problems can be identified with the aid of luteinizing hormone (LH) and follicle stimulating hormone (FSH) blood tests.
  • Male hormonal problems can be discovered with tests for total testosterone.
  • Other blood tests measure hormone levels that have an impact on numerous systems, including cortisol, 17-hydroxyprogesterone, DHEA-sulfate, ACTH, aldosterone, vitamin D, PTH, prolactin, and other estrogen analogues.
  • Thyroglobulin (Tg) tests can be used to track thyroid malignancy.
<h3>What is Endocrinology?</h3>

•Endocrinology is the study of endocrine glands.

•Endocrine glands are a group of glands in the body which secrete hormones.

•The purpose of the secreted hormones is to evoke a specific response in other cells of the body which are located far away.

Learn more about endocrine glands here:

brainly.com/question/11222803

#SPJ4

8 0
1 year ago
Animals making the territory with e
Sholpan [36]

Answer:

Animals making the territory with example Lion, Tiger, hyena among others

Explanation:

Animals marks their territory through secretion of pheromones, some makes sound, it is a form of behavioral act that allows to protect ones territory or boundary

5 0
3 years ago
What is the role of spindle fibers in mitosis?
Umnica [9.8K]

Answer:

They help equally devide the cell.

Explanation:

Spindle fibers form a protein structure that divides the genetic material in a cell. The spindle is necessary to equally divide the chromosomes in a parental cell into two daughter cells during both types of nuclear division: mitosis and meiosis. During mitosis, the spindle fibers are called the mitotic spindle.

SOURCE: Nature.com

Consider Giving this Answer Brainliest.

8 0
2 years ago
Read 2 more answers
Over the last several decades, the scientific community has gathered a large amount of information regarding genetics and geneti
Alenkinab [10]
<span>The two main sources that lead to increased genetic variation are:

</span>1. Gamete mutations
2. Recombination.

Gamete mutations:
Gametic mutations are the mutations that occur in germline cells (sperm and egg). Due to this, the mutations are able to be passed on from one generation to another. One of the most famous gametic mutations<span> is hemophilia.
</span>
Recombination:
Genetic recombination is the production of offspring with combinations of traits that differ from those found in either parent.
7 0
3 years ago
Which of the following is a component of rna but not a component of dna
Solnce55 [7]

Answer:

1. Ribose

Hope you have a great day :)

7 0
2 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • PLEASE HELP ASAP!!! WILL MARK BRAINLIEST!!!
    14·1 answer
  • From complete stop, a car reaches a velocity of 280 km/s east in 7 seconds. What is the rate of acceleration?
    9·1 answer
  • the writers and philosophers of the enlightenment believed that's government decisions should be based on
    6·2 answers
  • What is happening to boidiversity
    12·1 answer
  • Which of the following characteristics must an object possess in order to be considered alive?
    8·1 answer
  • How can a Punnett square predict results of crossbreeding in peas?
    7·2 answers
  • Which gas is most effective in absorbing incoming harmful ultraviolet radiation in the earth's stratosphere before that radiatio
    15·1 answer
  • Plate tectonic theory states that: *
    11·1 answer
  • Plants' leaves absorb energy from __________, which often comes from the Sun. What word completes the sentence?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!