1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
9

Anatomy focuses on the function and vital processes of the human body. true false

Biology
2 answers:
Stolb23 [73]3 years ago
4 0
I think it's True in not 100%
ki77a [65]3 years ago
3 0
It's true, because the anatomy of the body is almost like a diagram based on showing parts of your body. Please make me brainliest ❤
You might be interested in
Color blindness in humans is a sex linked trait. If the father has normal vision (XcY), and the mother is a carrier for the colo
Tamiku [17]
A or B I think is the answer
8 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
What is the time of year when the suns most direct rays reach farthest north or south
baherus [9]

Answer:

summer

Explanation:

3 0
3 years ago
Henry was studying two populations of the same species of lizards. One population lived on an island and the other lived on the
Arisa [49]
The answer is B. Genetic drift greatly affects small populations, but large populations can recover.
3 0
3 years ago
Which structure connects each kidney to the bladder?<br> Ureter<br> Urethra
Maslowich

Answer:

Two ureters.

These narrow tubes carry urine from the kidneys to the bladder. Muscles in the ureter walls continually tighten and relax forcing urine downward, away from the kidneys. If urine backs up, or is allowed to stand still, a kidney infection can develop.

Explanation:

6 0
4 years ago
Other questions:
  • Natural selection changes allele frequencies in populations because some ____ survive and reproduce more successfully than other
    6·1 answer
  • What’s the definition of substance
    10·1 answer
  • Indiana is home to fossilized crinoids. These small, sea-dwelling invertebrates are vaguely reminiscent of starfish, and some sp
    12·2 answers
  • E.O. is an 8-year-old girl with a history of asthma and allergy to bee stings. She has been brought to the clinic complaining of
    14·1 answer
  • how do you write 2 or 3 paragraphs to address the evolutionary history/advances from the monerans to protists to fungi?
    7·1 answer
  • 2. While playing in a park, a child was stung by a wasp. Some elders se
    15·1 answer
  • Gg is a heterozygous genotype that would show
    9·2 answers
  • How do marshes contribute to land building?
    6·1 answer
  • How dose the brain processes information from<br> stimuli? write 5 to 7
    10·2 answers
  • I hope you can help me &lt;3
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!