1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksju [112]
3 years ago
11

Petrochemicals include things like _____.

Biology
1 answer:
saveliy_v [14]3 years ago
8 0
Petrochemicals include many things, I would say All of the above. Hope this helped! :)
You might be interested in
7.
liraira [26]

Answer:

Explanation:

 

3 0
3 years ago
Read 2 more answers
Explain the processes of photosynthesis and cellular respiration
Anuta_ua [19.1K]

Explanation:

photosynthesis converts carbon dioxide and water into oxygen and glucose.glucose is used as food by the plant and oxygen as a by-product.

cellular respiration convert oxygen and glucose into water and carbon dioxide water carbon dioxide a byproduct and ATP is energy that is transformed from a process.

6 0
3 years ago
Can you help me with this please i will give you a branlist and it’s science
atroni [7]

answer is A out of the choices

3 0
3 years ago
Read 2 more answers
The diagram shown represents a pair of homologous autosomes. The letters B and b represents genes for a certain trait. These let
Vesna [10]

Answer:

A

Explanation:

The two genes are B and b are located in the same spot, therefore they are alleles or alternative forms of the same gene.

8 0
3 years ago
Which line points to the myelin sheath?
UkoKoshka [18]
4.

Myelin Sheath is an insulator on the axon

Hope that helps! :)
8 0
3 years ago
Other questions:
  • Select the correct answer. What causes magma in the lower mantle of Earth to rise up toward the crust? A. The moon’s gravitation
    15·2 answers
  • An 84-year-old woman is admitted to the hospital with a diagnosis of dementia of the alzheimer type. what does the nurse know ab
    14·2 answers
  • When listening the levels of organization in organisms from smallest to most complex which level is just below organs complexity
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Newton’s second law states that force is equal to?
    13·2 answers
  • What are cell organells ?
    12·2 answers
  • Which land biome has the greatest diversity of plant species
    15·1 answer
  • A fertilization<br>B prophase II<br>C polyploidy<br>D crossing over​
    10·1 answer
  • 2.
    8·2 answers
  • What advantage does the phylogenetic classification system have over the Linnaean system ?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!