1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
12

What do an eye, a telescope, and a microscope have in common? A.They all reflect light to increase the size of an object. B.They

all contain lenses that act as photoreceptors to project an image. C. They all contain a transparent part with at least one curved surface that refracts light. D.They all refract light to make an object look closer.
Biology
2 answers:
Jet001 [13]3 years ago
7 0

C. They all contain a transparent part with at least one curved surface that refracts light.

Hope this helps!!

Colt1911 [192]3 years ago
4 0

Answer:

c

Explanation:

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
The hierarchy of life extends past individual organisms. Which of the following is the correct sequence, from least inclusive to
Anna71 [15]

Answer:

E. Population - community - ecosystem - biosphere

Explanation:

Population is the set of organisms of the same species

Community is where organisms of different species live and communicate together

ecosystem is a biological system where ocommunities and environment are present.

Biosphere is where all ecosystem are present.  (let´s say, the earth)

3 0
3 years ago
What is the main advantage of the present system of scientific naming for classifying organisms. A) It clarifies the distinction
hoa [83]
I believe it's c. what france would call a skunk is different than what america would call a skunk, but under binomials, because theyre universal, it would be memphitis memphitis to everybody.
4 0
4 years ago
A slow reproduction process is a disadvantage of which form of reproduction
Musya8 [376]
Sexual reproduction

Hope I Helped You!!! :-)

Have A Good Day!!!
5 0
3 years ago
Read 2 more answers
Name two methods other than vaccination for controlling viral diseases
zalisa [80]
<span>Vector control and Drug therapy are two other methods for controlling viral diseases. </span>
5 0
3 years ago
Other questions:
  • Explain your observations on what organisms need to grow. Also discuss ways in which human activity can impact an organism’s abi
    11·2 answers
  • Phosphorus is atmotic number 15 When it comes to bonding with other atoms, what is phosphorus most likely to do?
    10·1 answer
  • Eukaryotic cells. Classify each statement according to whether it occurs in eukaryotic cells, prokaryotic cells, or both.
    13·1 answer
  • Junipers, hemlocks, and cedars belong to which group of gymnosperms?
    8·2 answers
  • If the egg cell of animal has 25 chromosomes,how many chromosomes would be in a heart cell?
    12·1 answer
  • Name the most important glucocorticoid secreted by the adrenal cornex.
    13·1 answer
  • A key element to any sciences to make testable exclamations and predictions based on your observations Marissa has observed that
    13·1 answer
  • What would IC 559 be classified as
    14·2 answers
  • What is the function of mRNA?
    6·1 answer
  • At which point does warm air begin to rise before colliding with cold air? 1 2 3 4.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!