1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Usimov [2.4K]
3 years ago
9

How do bone markings on modern human skeletons relate to bone markings found on the fossils of common ancestors?

Biology
1 answer:
STALIN [3.7K]3 years ago
3 0

Answer:

Explanation:

As with the other markings, their size and shape reflect the size of the vessels and nerves that penetrate the bone at these points. ... The surface features of bones depend on their function, location, attachment of ligaments and tendons, or the penetration of blood vessels and ner

You might be interested in
Describe how each of Newton’s laws may be observable during a car trip.
aleksandrvk [35]
According to Newton's first law, an object in motion continues in motion with the same speed and in the same direction unless acted upon by an unbalanced force. Any passengers in the car will also be decelerated to rest if they are strapped to the car by seat belts. Also if a car was going straight but another car (unbalanced force) bumps into it causing the motion of the car to change.
8 0
3 years ago
I need help can someone help me it is a weather question
viktelen [127]

Answer:

I belive the answer is C

7 0
2 years ago
Read 2 more answers
How are mean and median alike?how are they different?
Vlada [557]

Answer:

Mean is the average you'll get when you add all your numbers then divide by the number of numbers you have. On the opposite side, median is the middle number within your list of numbers. If there isn't a middle number, take the two middle numbers and add them. Now, for how they are alike, I'm not so sure :'), but my closest guess would be they are fairly close together.

Sorry it's so long, hope I helped you :')

Explanation:

7 0
3 years ago
Who showed that plants were made of cells.
Marta_Voda [28]

Answer:

Theodor Schwann

Explanation:

7 0
3 years ago
Read 2 more answers
Aqueducts are artificial channels for transporting water.
Effectus [21]

True

Explanation:

Aqueducts are constructed channels for transporting water from one point to another.

  • They were first constructed by the Roman to move water from hollow valleys and narrow areas.
  • Today, aqueducts include canals, ditches, gutters, channels that are used to carry water.
  • Aqueducts aids the movement of water from one place to another.
  • Development of aqueducts by the Romans was seen as a great advantage in that civilization.

Learn more:

Canals brainly.com/question/11377972

#learnwithBrainly

3 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A nurse is assisting with assessment of the internal eye structures of clients in an ophthalmologist’s office. what would the nu
    15·1 answer
  • When cells express different genes, what occurs?
    11·2 answers
  • When you are ill with a cold, you fix a bowl of chicken noodle soup to eat to feel better. what factor drives your food choice i
    10·1 answer
  • Which describes the paleoanthropology practice of walking the landscape looking for fossils on the surface?
    9·1 answer
  • If someone is skateboarding down a hill which type of energy is decreasing
    9·1 answer
  • One scientific investigation may result in
    8·1 answer
  • Describe the characteristics of the phospholipid bilayer that permit small hydrophobic lipid molecules to pass directly across t
    12·1 answer
  • What is the effect of medicines given to people suffering from viral diseases?
    5·1 answer
  • Which of the following can occur at breaks in the earth's crust?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!