Answer: It is an amino acid that cannot be made by the body. It must be obtained from eating certain foods.
Explanation:
Answer:
In the human adult, the bone marrow produces all of the red blood cells, 60–70 percent of the white cells (i.e., the granulocytes), and all of the platelets. The lymphatic tissues, particularly the thymus, the spleen, and the lymph nodes, produce the lymphocytes (comprising 20–30 percent of the white cells).
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
D) the sum of all physical properties of a substance
Answer:
A. chromosomes
Explanation:
Chromosomes are structures found in the center (nucleus) of cells that carry long pieces of DNA. DNA is the material that contains genes and is the building block of the human body.
Chromosomes come in pairs. Normally, each cell in the human body has 23 pairs of chromosomes (46 chromosomes in all), of which half comes from the mother and half from the father.