1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
morpeh [17]
3 years ago
7

Both animal and plant cells are eukaryotic cells. What is the difference between animal and plant cells?

Biology
2 answers:
kramer3 years ago
6 0

Answer:

A. Plant cells have cell walls and chloroplasts, Animal cells do not.

Explanation:

topjm [15]3 years ago
3 0
The correct answer is a,
You might be interested in
2. DNA contains the genetic code that determines the structure and function of living things. What do the base pairs in DNA prov
Lera25 [3.4K]
The answer is a. because that's your personality.
5 0
3 years ago
A marine scientist measures the energy found in a system consisting of seagrass and sunlight. After the seagrass grows for one w
valentina_108 [34]

Answer:

Validate

Change of one form of energy into other can occur according to the law of conservation of energy.

Explanation:

According to the law of conservation of energy, energy can not be created or destroyed. However, one energy form can be transformed into another form. These energy transformations also occur in ecosystems.  

In the given example, the solar energy from the Sun was used by seagrass to perform the process of photosynthesis.

During the process, the energy from sunlight was converted into the chemical energy of organic nutrients (glucose). Part of these nutrients is used by seagrass as an energy source while rest is stored in its tissues. The transformation of radiant energy from the Sun into the chemical energy of nutrients present in seagrass follows the law of conversation of energy.  

8 0
3 years ago
Why is light emitted by elements when they are heated?
masya89 [10]

Answer:

Heating an atom excites its electrons and they jump to higher energy levels. When the electrons return to lower energy levels, they emit energy in the form of light.

Explanation:

hope this helps plz mark brainliest

7 0
2 years ago
Why would your body have trouble maintaining homeostasis if you are sick with a very high fever?
Anuta_ua [19.1K]
Although the evidence is only indirect, fever is believed to enhance the body's immune response. The increased temperature may actually impair the replication of infecting bacteria and viruses that are adapted to survive best at your normal homeostatic body temperature range. Hope this helps.
8 0
3 years ago
Cholesterol is repelled by water and can be found between the layers of the phospholipids in the plasma membrane. What can be co
Vlad1618 [11]

Answer:

The correct option is <em>B. Cholesterol is non-polar.</em>

Explanation:

Cholesterol is a non- polar substance and due to this property it is an active part of the cell membrane. Cholesterol molecules help to maintain the stability of a cell. When the temperatures are high, cholesterol stops the cell membrane from crystallization. When the temperatures are low, cholesterol reduces the packaging of molecules of phospholipids. As a result, fluid phase is archived by the cell membrane.  

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What are the water soluble vitamins and what are the fat soluble vitamins? Which ones must be part of your daily diet and why?
    10·2 answers
  • in gel electrophoresis, DNA fragments move across a gel. describe what cause them to move in (2-3) sentences
    9·2 answers
  • What is the correct answer?
    6·1 answer
  • What is natural selection and what are its effects on allele frequencies? (Due at 11:59)
    9·1 answer
  • Which organism is the primary producer<br> 1)Grass<br> 2)mushroom<br> 3)snake<br> 4)eagle
    10·2 answers
  • Ultraviolet light might cause DNA damage, which is known as a mutation. How might such damage affect events that take place duri
    5·1 answer
  • Describe what an ecosystem is.
    15·2 answers
  • The absorption of human-generated co2 by the oceans __________.
    14·1 answer
  • The center of our galaxy contains a very intense source of radio and x-ray radiation named sgr a*. what is it about this source
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!