1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
3 years ago
14

A substance called _____ contains the instructions for life.

Biology
1 answer:
salantis [7]3 years ago
4 0
<span>DNA is the substance within every living cell that contains the instructions for life.</span>
You might be interested in
The ability to change color to avoid predators is a?
ZanzabumX [31]
It is called camouflage
5 0
3 years ago
Read 2 more answers
What is the relationship between biodiversity and number of populations?
noname [10]
Biodiversity increases as the number of populations grow, because a greater population generally means a more diverse one.

However, this is not always true, so I'm not sure what answer they're looking for.
7 0
3 years ago
Secondary consumers may be ____ eating meat or _____ that eat both plants and animals
Solnce55 [7]

Secondary consumers may be carnivores that eat meat or omnivores that eat both plants and animals.

<h3>What are secondary consumers?</h3>

Consumers in biology are organisms (heterotrophs) that uses other organisms for food in order to gain energy.

Consumers can either be primary or secondary. Primary consumers feed directly on plants, hence, are said to be herbivores.

On the other hand, secondary consumers feed majorly on primary consumers, making them carnivorous in nature.

However, secondary consumers may be carnivores that eat meat or omnivores that eat both plants and animals.

Learn more about secondary consumers at: brainly.com/question/14171839

#SPJ1

5 0
1 year ago
Which of the following best describes succession?
Gwar [14]

i think it is B or A they make the more sense hope this helps ✌

8 0
3 years ago
ASAP!! HELP PLEASE!! I WILL MARK YOU BRAINLIEST!!!
N76 [4]

Answer:

C

Explanation:

Im not 100% sure but I'm almost 100% sure thats the answer

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which organisms are not examples of an adaptive radiation?
    10·1 answer
  • How does the ocean floor keep track of magnetic fields?
    13·1 answer
  • Please help me ASAP
    5·1 answer
  • The image on the screen is a picture of a hydrated
    13·1 answer
  • A veterinary team is called to a ranch after the rancher found a cow that had been lost for the past week. The cow is down and h
    11·2 answers
  • For each function listed below, name the associated structure: Function Structure Rigid cellular support __________________ Flex
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • 4. What happens to animals that do not eat food (glucose)? Explain in detail what is<br> happening.
    12·2 answers
  • How do particles of salt and dust affect cloud formation?​
    6·1 answer
  • Two trains are traveling down a track. Train A has more mass than Train B. What will happen when the two trains attempt to stop
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!