1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
6

Two ways 5 people can share a 3 segment chewy worm

Biology
1 answer:
Alinara [238K]3 years ago
7 0
I tried my best, well i hope this helps. Good luck.

You might be interested in
3. If a human produces 1 million proteins, but human DN only codes for 25,000 genes, on average how many proteins are produced p
elena-14-01-66 [18.8K]

Answer:

40 protein produced each

Explanation:

take 1 million and divide it by 25,000, it should say 40

7 0
3 years ago
Sylvia's name means "forest." how does this aid in her characterization?
daser333 [38]

it aids her because it is part of her name and it is helping her by letting her know that she is one of a kind

8 0
3 years ago
In radishes, the gene that controls color exhibits incomplete dominance. Pure-breeding red
Ghella [55]

Answer:

The possible genotype of this cross is RW

Explanation:

This question involves a single gene coding for radish color. The allele for red radish (R) is incompletely dominant over the allele for white radish (W), hence, a third intermediate phenotype is formed when they combine (RW).

In this cross, a pure-breeding red radish (RR) is crossed with a pure breeding white radish (WW) to create the F1 offspring. The red radish will produce gametes R while the white radish will produce gametes W, hence, using a punnet square (see attached image), the F1 offspring will have the genotype: RW.

6 0
3 years ago
Does cellular respiration requires nutrients or glucose?​
AleksandrR [38]

Answer:

Every cell of the body needs oxygen for the process of cellular respiration by which the energy in food is converted into energy that can be used by the body's cells. During cellular respiration, glucose and oxygen are converted into carbon dioxide and water, and the energy is transferred to ATP.

4 0
2 years ago
82. Your research team has recently identified a new gene and named short arm that when mutated causes the limb bud to cease gro
Aloiza [94]

Answer:

The creation of the limbs is carried out by AER and ZVP. AER stands for apical ectodermal ridge and ZVP stands for polarising activity line.

Explanation:

  • AER is responsible for the developmental progression in the distal to the anterior region and the ZVP is liable for the progressive advancement in the posterior to a backward region.
  • AER and ZVP are interconnected on one another in the secretion of a sonic hedgehog, which eventually assists throughout the hox speech to promote the growth of the arm.
  • The hypothesis that the new short-arm gene inhibits the effect of FGF (fibroblast growth factors) on AER can be tested and use a template of cultured cells.
  • The AER may be disrupted in the model and the impact of the gene encoding on FGFs may be examined. If in the existence of a viral vector, the role of the FGFs is to trigger correct growth, then the hypothesis is incorrect, or else the hypothesis is right. The FGF8 is by far the most powerful of all as the result.
3 0
3 years ago
Other questions:
  • How are aerobic and anaerobic systems involved in nutrient cycling
    15·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Why do we use arrows when creating a food web? What do they represent?
    14·1 answer
  • In a chemical reaction, the chemicals you start with (those in the rectangle) are called ____________________. The ones you end
    12·1 answer
  • What is the thing that represents mitosis?<br>(and it has to be a living thing)​
    6·2 answers
  • In what way are pathogens similar to hormones and enzymes?<br> Can Somebody please help me thx :D
    10·1 answer
  • PLEASE HELP!! Which of the following happens when cancer occurs?
    12·1 answer
  • In which stage Ig the Calvin cycle does the plant cell produce energy for storage? On Plato
    12·1 answer
  • 3. What are the most extreme temperatures at which life been found on earth?
    10·1 answer
  • ____ is the academic discipline that investigates visual media and its effect on entertainment, information, political power, an
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!