1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harkovskaia [24]
3 years ago
11

Dephosphorylation occurs when ATP molecules convert into ADP molecules. true or false

Biology
1 answer:
natali 33 [55]3 years ago
4 0
The correct answer is true:)
You might be interested in
The basic function of the kidneys is to filter waste products from the blood plasma and secrete them as urine. It accomplishes t
NeTakaya

Answer:

this doesn't look like a question

7 0
3 years ago
How would we classify bacteria that use hydrogen sulfide to make food?
lbvjy [14]
Sulfate-reducing bacteria. I saw something about chemosynthetic bacteria if that helps. I hope I'm right.
8 0
3 years ago
Read 2 more answers
Which of the following statements best describes interphase?
Zina [86]

Answer:

The correct answer is - option B. Interphase is made up of the G1, S, and G2 phase and is the portion of the cell cycle where cellular contents are duplicated.

Explanation:

Interphase is the phase in the cell cycle in which the cell prepares to go under cell division by growing in size, replicating, or duplicate the cellular contents like DNA or genetic material and prepare for mitosis. Interphase includes the substages G1, S, and G2 phases.

It is known as the longest stage of the cell cycle as it includes four substages that takes time due to growing the cell, double the content and make the cell ready to go under division.

4 0
3 years ago
select the correct answer sickle cells  disease is a hereditary mutation that causes The red blood cells to the form decreasin
UNO [17]

Answer:

Sickle cell disease is due to a type of substitution mutation.

Explanation:

Sickle cell disease is a condition that is transmitted from parents to children in an autosomal recessive inheritance pattern. It is due to a mutation that is capable of altering the shape of the erythrocyte, as well as its ability to circulate and carry oxygen.

The mutation that occurs in sickle cell disease is due to an alteration in the β-chain of hemoglobin, caused by the substitution of thymine base by adenine in the DNA that determines it. As a result, valine replaces glutamic acid in the β-chain amino acid sequence, with the consequences described.

  • <em>The other options are not correct because </em><u><em>deletion, duplication and translocation </em></u><em>correspond to chromosomal mutations, not responsible for sickle cell disease.</em>
8 0
3 years ago
Why is it beneficial to use textiles made from synthetic fibers
mestny [16]
Synthetic fabrics<span> are </span>textiles made<span> from man-</span>made fibers<span> rather than natural </span>fibers. Chemically produced fabrics<span> are </span>made<span> by joining monomers into polymers, through a process called polymerization. A </span>synthetic fabric<span>, when magnified, looks like plastic spun together.</span><span>

Natural fabrics, such as cotton, silk, and wool, are made from animals or plant based fibers. While synthetic are man made and produced entirely from chemicals to create fabrics. such as polyester, rayon, acrylic, and more. The benefits of using textiles made from synthetic fibers is that it saves the animals and plants that the fibers are based off of. 

Hope this helped :)

</span>
5 0
4 years ago
Other questions:
  • Which of the following is a way to conserve water quantity a A buying bottled water B reducing the amount of detergent use in th
    11·2 answers
  • Match each term with the appropriate definition.
    8·1 answer
  • Suppose a suspicious hair was found in a victim's home. a gel is set up with the dna fragments of two suspected criminals in lan
    5·1 answer
  • A person has part of their lung removed through surgery. Which of the following correctly describes how conditions in their body
    8·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What scientist developed the cladistic classification
    10·1 answer
  • Explain it to me please
    14·2 answers
  • Arthur is testing how well various types of disinfectants can kill E. coli bacteria. He starts with a Petri dish that is covered
    15·1 answer
  • Help Please I'll give brainliest
    14·1 answer
  • Maltose and Lactose both contain the same number of atoms of each element, C, H and O. State two other structural similarities b
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!