1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maks197457 [2]
3 years ago
10

What producers serve as the basis of the food chain in this layer of the ocean answers?

Biology
1 answer:
Norma-Jean [14]3 years ago
7 0
In the first segment that covers the top part of the ocean the whale sharks producers serve as the basis of the food chain. In the top layer of the ocean enough sunlight hits the water which makes it a good place for planktons to grow. These planktons are then eaten by the whale sharks.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Buony
sasho [114]
My lg is driplikemessiah and just look up the
4 0
2 years ago
Which of the following statements best describes a decomposer?
Kitty [74]

Answer:

b

Explanation:

6 0
2 years ago
Which of the following is a result of the transfer of energy
astra-53 [7]
What are the choices?
3 0
3 years ago
Read 2 more answers
Each of the two daughter (or offspring) cells
Dennis_Churaev [7]

Answer:

2) The same number of chromosomes and genes identical to those of the parent cell

5 0
2 years ago
Other questions:
  • The Lotka–Volterra models show that coexistence is more likely if A. Niche overlap is small and the carrying capacities are diff
    15·1 answer
  • The farm uses a variety of pesticides on its corn crop. What is a likely result of this?
    14·2 answers
  • If two forces push or pull an object will the object move
    6·2 answers
  • Tundra means “treeless land.” <br> True or False
    14·2 answers
  • What is the purpose of the pericardial sac that surrounds the heart in mammals
    13·1 answer
  • The brightest color emitted by the sun is
    9·1 answer
  • Nucleic acids offer variability because they contain alternate for of genes called what
    10·1 answer
  • Not sure about this probably simple bio question
    12·1 answer
  • What do all of these samples have in common?
    15·2 answers
  • Can males be carriers? Explain.<br> Normal traits - <br><br> Sex-linked traits -
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!