1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
3 years ago
5

Would spinach leaves have a greater rate of photosynthesis in the bicarbonate solution you created or in atmospheric air? suppor

t your answer. • does the light-independent pathway of photosynthesis continue to occur when the leaf disks are placed in the dark environment? • write a short discussion describing trends in the data: compare the control cups (distilled water) versus the experimental cups (bicarbonate solution) and compare the light versus dark environments. • was your hypothesis supported or refuted? write a one-to-two sentence conclusion to summarize your experimental findings.
Biology
1 answer:
Ymorist [56]3 years ago
3 0

Explanation:

The spinach leaves would have a higher photosynthetic rate due to the additional carbon dioxide provided from the sodium bicarbonate solution. Sodium bicarbonate NaCO3, breaks down to release dissolved carbon dioxide gas. This is taken up by the leaf for photosynthesis which begins in the stroma. Here,chlorophyll, a specialized compound which facilitates the conversion of light energy to energy stored in carbohydrates in the process photosynthesis.

Photosynthesis is a chemical pathway that’s integral to producing energy in plants and other primary producers. Energy in the form of molecules of glucose is produced from light, water and carbon dioxide while oxygen is released. This occurs in several complex steps, photosynthesis is a rate-limited reaction, depends on several factors including carbon dioxide concentration, ambient temperature and light intensity; the energy is retrieved from photons, I.e. particles of light, and water is used as a reducing agent.

Water supplies the chlorophyll in plant cell with replacement electrons for the ones removed from photosystem II. Additionally, water (H2O) split by light during photolysis into H+ and OH- acts as a source of oxygen along with functioning as a reducing agent; it reduces the molecule NADP to NADPH by providing H+ ions. NADP and NADPH are integral to the Calvin cycle where monosaccharides or sugars like glucose are produced after the modification of several molecules.

6CO2 + 6H2O + light energy → C6H12O6 + 6O2

  1. No, the light-independent pathway cannot occur when the discs are placed in the dark environment-this is because during the light dependent process then the products of light dependent reactions ATP and NADPH, along with several enzymes are used in the Calvin cycle which produces energy storage molecules like sugars/ carbohydrates and other organic molecules. Respiration, occurs at the same time,producing CO2 as a byproduct. However, this doesn't affect photosynthesis; plants are living organisms that need more energy for metabolic processes like the Calvin Cycle .
  2. Photosynthesis occurs faster in the cops containing bicarbonate solution. This is due to the increased amount of carbon for use by the leaves in photosynthesis; the rates of reaction are higher in light environments because photosynthesis is a light-dependent process; the energy used and the light-dependent reactions produces ATP and NADPH which are then used to begin the Calvin cycle.
  3. This supports the hypothesis, that the syringe containing sodium bicarbonate at higher light intensities would produce more floating disks due to higher rates of photosynthesis, which releases water and Oxygen gas as end products, causing the disks to float to the top. Conclusion:<em>Thus at higher intensities of light, and in the pesence of sodium  bicarbonate i.e. light environments the rate of photosynthesis is also higher and  will occur faster; the Oxygen produced makes more leaf disks float.</em>

Learn more about Photosynthesis at brainly.com/question/4216541

Learn more about cellular life at brainly.com/question/11259903

#LearnWithBrainly

You might be interested in
Which dimension of health involves placing the needs of others above your own?
erica [24]
The answer to this question is  C. Spiritual health
The spiritual health dimension focused on doing all your actions based on the 'greater goods'. Completing this dimension will improve your wellness because it often gives your life a purpose/motivation that will give you more sense of fulfillment when you manage to finish your goals 
6 0
3 years ago
Read 2 more answers
What are the eight characteristics of living things?
rjkz [21]
Cellular organizations
reproduction
metabolism
homeostasis
heredity
response to stimuli
growth and development
adaptation through evolution
I hope this helped you
6 0
3 years ago
What part of the body does erythropoietin (EPO) target to increase erythropoiesis?
vodka [1.7K]
The part of the body that erythropoietin (EPO) target to increase erythropoiesis would be bone marrow. It <span> is a substance produced by the kidney that leads to the formation of red blood cells in the bone marrow. Hope this answers the question. Have a nice day.</span>
6 0
3 years ago
Compare sacred places in buddhism to those in islam. what do they have in common?
Archy [21]
<span>Buddhists and Islam commonly construct their sacred places in their own homes. Buddhists build shrines in their own homes for personal worship, meditation, and offerings for Buddha.  A mosque, the Islam place of worship is any place devoted to prayer. It could be a house, or an open area of ground that was considered sacred.</span>
3 0
3 years ago
Read 2 more answers
In pea plants, red flowers and round pollen are known to be recessive traits. In a dihybrid cross experiment, lots of plants wit
motikmotik

Answer:

The last one if there are multiple answers please tell me.

Explanation:

just when with the one i knew in heart

8 0
3 years ago
Other questions:
  • Human actions cannot change Earth’s atmosphere. true or false? with explaining please I will award brainiest
    6·1 answer
  • Which of the following substances protect skin from ultraviolet radiation?
    7·2 answers
  • The repolarization of cardiac muscle is due to _______.
    5·1 answer
  • Inflammation, your skin, and macrophages are all part of the body's ___ immune system response to a pathogen. allergic general p
    15·2 answers
  • During DNA replication, two extra guanine bases are added to the DNA. What type of mutation is this? A. Nondisjunction mutation
    7·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Write a summary statement for unsaturated fats including whether they are solids or liquids at room temperature and whether they
    9·2 answers
  • What are two ways in which the value of soil can be reduced?
    9·1 answer
  • In drosophila the anterior-posterior axis is established bya. The distribution of the RNA-binding transcription factor called bi
    11·1 answer
  • The projections move the prokaryote through its environment is known as ribosome
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!