1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
4 years ago
12

What subcomponent of universality makes explicit the understanding not only that all living things die but also that each living

thing will die?
Biology
1 answer:
shusha [124]4 years ago
7 0

Answer:

The options

A. Personal mortality

B. Inevitability

C. Purposefulness

D. Organicity

The CORRECT ANSWER IS A.

A. Personal mortality

Explanation:

Universality

It as to do with the fact that all living things must gradually or at some point die. It sees Death as an all-inclusive, inevitable, and unavoidable.

A. personal mortality✔✔✔

It is the concept that death applies to oneself, that not only do all living things die but each and every living thing will surely die.

B. Inevitability❌

It is the concept that all living things must one way or the other encounter death.

C. Purposefulness❌

It has to do with death and it's purpose.

D. Organicity❌

It is the probable etiology of the inadequacy of full eyelid closure at death.

You might be interested in
Which describes a fungus–plant root association?
BartSMP [9]

Answer: c. symbiotic mutualism

Explanation:

Mutualism is a symbiotic relationship in which both species benefit

6 0
3 years ago
Read 2 more answers
What property of water allows nutrients and gases to move throughout the body is it adhesive or cohesive
devlian [24]

I think it is Cohesive because the water molecules are being pulled up

3 0
4 years ago
Curly hair (C) is dominant to straight hair (c). What must the genotype of the parents be to produce CC Cc CC Cc
Zanzabum

Answer:

CC and Cc

Explanation:

6 0
3 years ago
Read 2 more answers
It is crucial tjthat the process of mitosis is error free. This is Becca use otherwise healthy cells can
Alex17521 [72]

Mitosis is one of the precious processes. If it goes wrong then the results will be terrible as it can even bring death to the organism or uncontrollable mutation.


Mitosis is the process in which a cell replicates itself to produce a copy of it. As a result of mitosis, each cell carries the copies of the original cell’s DNA.  


The uncertain error in mitosis will cause a mutation which affect the amino acid sequence and further functions. This will lead to the cell cycle disruption that can lead to the formation of cancer cells that are uncontrollable in dividing itself.

6 0
3 years ago
All living things exist within the
Sliva [168]
Troposphere. Hope this helps.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which finches would be most like the ancestral finch?
    5·1 answer
  • Even though all cells have different shapes and sizes they also all have cytoplasm and a
    9·2 answers
  • Should scientists infer evolutionary relationships based on data from a single protein?
    7·1 answer
  • PLEASE HELP!!!!!!! Please just give your best answer. It doesn’t need to be long or explained. I JUST NEED AN ANSWER!!!!!!!
    7·1 answer
  • Which of the following features are not known to be caused by plate tectonics?
    5·2 answers
  • A period in the embryonic stage during which certain developments must occur because they will not occur later is called the ___
    6·1 answer
  • Which phrase describes short-term environmental changes?
    10·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Water is found throughout the earth. It is comprised of hydrogen and oxygen atoms. Water changes into different physical states
    12·1 answer
  • Tell me one thing you know about replication.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!