1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bond [772]
3 years ago
8

What is ambulocetus?

Biology
1 answer:
Keith_Richards [23]3 years ago
7 0

Answer:

A ambulocetus is a walking whale and it is about 11-12 feet long also they had strong limbs.

Explanation:

You might be interested in
What are the function of areolar tissues ?
uysha [10]

Areolar tissues are loose tissues that usually adhere to epithelia. Areolar tissues contain blood vessels(we know epithelial tissues don't have blood vessels). Their main role is to procure food for epithelial tissues.

7 0
3 years ago
When a virus invades a host the most common threat is
mylen [45]
The answer is c because we just learned about it today. Viruses destroy cells
6 0
3 years ago
How are hosts and parasites related?
Firlakuza [10]
They are related because they share the same body. The parasite<span> lives off the </span>host's<span> body.</span>
4 0
4 years ago
Read 2 more answers
Why aren’t organisms on the sea floor crushed by water pressure and how much pressure inside them is pushing out at the ocean?
Lerok [7]
This is because they contain air: that feeling comes from the air sacs in your body being squashed by the pressure of the water. Fish living closer to the surface of the ocean may have a swim bladder – that's a large organ with air in it, which helps them float up or sink down in the water
5 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Other questions:
  • What are the four types of organic compounds?
    11·1 answer
  • Muscle contractions
    15·1 answer
  • assess the similarities and differences between the somatic nervous system and the autonomic nervous system
    8·1 answer
  • What is one way intensive agricultural practices contribute to climate change?
    13·1 answer
  • Darwin realized that ____ variation ________________ must be the starting point for change in nature. In any generation, the ani
    14·2 answers
  • Most mammal cells divide at a rate of
    12·1 answer
  • Please select the word from the list that best fits the definition measures temperature​
    5·1 answer
  • Essay
    8·2 answers
  • A web of proteins in the cytoplasm that keeps a cell's membrane from collapsing is a?​
    8·1 answer
  • Does a nerve cells contain a cell wall and a large, central vacuole? Explain why or why not.​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!