Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
Sexual selection
Explanation:
It is sexual selection because it is a type of natural selection in which an organism or organisms acquire traits which help the individual to be choose as a mating partner or to have preference for a mating partner or for competition among one sex organisms in which a traits succeed.
Sexual selection can be intrasexual or or intersexual. Intrasexual is is competition between one sex of the same organism and intersexual is between sexes of different organism.
Answer: Option A) Double-stranded DNA
Explanation:
First, the presence of thymine infers that the genome is DNA.
Then, to determine whether it is single or double stranded, we check if the sum of all nitrogenous bases is equal to 100%
A + C + G + T = 100%
28% + 35% + 20% + 17% = 100%
Since all bases makes 100%, we can conclude that the genome is a double stranded DNA
A solution is a compound, or a mixture and will probably show a slight discoloration or blur.
There are several stages but the crossing over starts on the second stage. And the actual crossing sides happens on the following stage. Hope this helped :)
