1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
2 years ago
15

How would results vary between observing a population directly as opposed to observing them indirectly?

Biology
2 answers:
ioda2 years ago
3 0

Answer and Explanation:

Observing population directly gives you accurate result .

Direct observation does not need any intermediary as they themselves go for survey.

So, it is cost efficient.

Whereas indirect observing may involve manipulations.

It requires someone or many to hire who helps in surveying.

It incurs cost.

Thus, direct observation is always better than indirect observation.

kondaur [170]2 years ago
3 0

Answer:

On the subjects, direct observation can be made by noticing the behaviors they possess in their natural habitat. In order to gather the information, the investigator can either hide to prevent any intrusion or can be either present physically to record the observations with the help of a camera. For example, recording or watching a chirping bird.  

On the other hand, indirect observation comprises recording of the traces left behind by the subject to comprehend the cause behind the behavior demonstrated by the subject. For example, recording the distribution of the bird droppings to determine their movement.  

Therefore, it can be concluded that direct observation helps in determining the behavior in a population and an indirect observation will assist in developing the cause behind the witnessed behaviors in the population.  

You might be interested in
Why is genetic variation important? Select all that apply:
Sladkaya [172]

Answer:

Genetic variation in a group of organisms enables some organisms to survive better than others in the environment in which they live. Organisms of even a small population can differ strikingly in terms of how well suited they are for life in a certain environment.

Explanation:

Genetic variations are important because a diverse gene pool is good for long-term survival of a species since the environment is always changing, so the diversity of DNA offers the most fit of the species a better chance of surviving because they are most adapted to the constantly changing environment.

7 0
1 year ago
How does glucose turn into cellulose and starch and why?
Minchanka [31]

Answer:

they are very similar in what they are made of.

Explanation:

sorry

6 0
3 years ago
Many polyploid plants, such as the bananas shown here, are grown commercially because they are often larger and healthier than n
larisa [96]
The genetic mulation

7 0
3 years ago
Read 2 more answers
The cellular machinery responsible for protein synthesis is the:.
sveticcg [70]
The cellular machinery responsible for protein synthesis is the ribosomes.
3 0
2 years ago
Explain the analogy that was used to explain DNA Mulations? Idk
Lera25 [3.4K]

Answer:

Explanation:

An example of this analogy might be that the surrounding the central dogma which is compared to making yout mum's recipe for brownies.

First, you ought to call your mum, she stands for the DNA. Then, you pay attention in listening and copying down her instructions. This is can be compared to transcription because during transcription, DNA is copied to mRNA.

Any mistake you do during listening and copying leads to mutation caused by insertion or omission.

4 0
2 years ago
Other questions:
  • Which of the following processes does not involve transferring carbon from the living environment to the nonliving environment.
    13·1 answer
  • 2. Laertes is known to be wild child.<br> O<br> O<br> True<br> False
    6·1 answer
  • Number 41. This is so confusing. And please explain why you choose that answer
    11·1 answer
  • If you had to pick a specific food that was high in potential energy to include in your diet, which food would you pick and expl
    15·2 answers
  • You are studying two traits in fruit flies: Eye color where there are two colors, brown and red, and wing shape where there are
    6·1 answer
  • A frog captures and consumes a fly. Which example of the characteristics of life is most similar?
    8·2 answers
  • In figure 32-3 a muscle that moves food through your digestive system is shown in
    5·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Help bonus points<br>real ans plzz​
    5·1 answer
  • A mouse population lives in an area with tan colored soil The number of mice with tan coats and the number of mice with dark gra
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!