It's important so that they know exactly where the disease started. Knowing who patient zero is helps them to identify who that person interacted with. From there, they can determine where the disease spread to. This will aid them in stopping the disease before it spreads any further.
B because theyre in order of the number of protons
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
In co dominance, both alleles show. Thus, the filial, F1, generation, will most likely be white with red spots/speckles. See image below.
Answer: Several behaviors can be considered as cuts when dealing with a client.
Explanation:
Human beings are social beings, we like to interact with each other, but often these interactions do not always occur in the right way. There are several jobs where people have to have an approach with the client and treat them in the best way, which is part of providing a good service.
Various behaviors are considered as cuts when dealing with a client, one of them is being efficient and friendly. When a client enters the person must show a friendly attitude, which allows the client to express what they need. Efficiency must also be shown at the time of performing the work since a person who is occupying a job is because he is capable of performing the work.
Another behavior that can be considered as cuts when dealing with a client is to listen actively. Many people make the mistake of not actively listening to their customers, which can often cause problems when providing a product or service, or simply listen to the customer's complaints. It is important to make the client feel that he is heard, that what he has to say is important.
Keeping calm in any situation is also a way of being courteous to the client. Each person is different, so not all of them will have the same mood at that time. It is important to remain calm and be professional when dealing with a client. It is not correct to respond inappropriately if the client does so, professionalism must be above all. If a client behaves in a certain way, reporting it might be a good idea, but not reaching the point of using the same tone or way of acting that the client used at the time.
