1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
77julia77 [94]
3 years ago
9

What did Virchow observe that led him to determine one of the main components of cell theory?

Biology
2 answers:
Aloiza [94]3 years ago
7 0

Answer:

The answer is A, I took the quiz.

Explanation:

mr Goodwill [35]3 years ago
4 0

Answer:

a cell splitting into two cells

Explanation:

hope this helps mark me as brainliest pls :)

~Alex

You might be interested in
ANSWER ASAP!!!!!!
Nana76 [90]

Answer:

explosive is the word that would identify one stage of a volcanic activity

4 0
3 years ago
Read 2 more answers
Farmer Tom only breeds the largest hogs, the fastest horses, and the cows 1 point
Marta_Voda [28]

Answer:

Artificial Selection

Explanation:

8 0
3 years ago
Read 2 more answers
There’s one more option
earnstyle [38]

Answer:

1

Explanation:

3 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
How frequently can scientists prove that their hypotheses are true?
ZanzabumX [31]
Scientists prove their hypothesis is true about Scientists can never "prove" their hypotheses are true, because some future experiment, possibly using new technology not currently available, might show the hypothesis to be false after all.
4 0
3 years ago
Other questions:
  • Explain how human activity, pollution, and acid rain are all related to each other
    7·1 answer
  • The force of an attraction that the earth exerts on all objects is called _____
    5·2 answers
  • How has the human population changed since the development of
    6·1 answer
  • A single hydra can produce offspring by growing a new individual from any portion of its body. What is the reproduction method o
    5·2 answers
  • Earth's core is interpreted to consist mainly of ________. granite
    15·2 answers
  • Social networks and the reciprocal norms associated with these networks that encourage people to do things for each other are kn
    5·2 answers
  • Which of the following planets has the largest canyon in the solar system? Jupiter Mars Neptune Venus
    12·2 answers
  • Some insects can walk on the surface of water. Which behaviour of water is responsible for this phenomenon?
    6·1 answer
  • Helpp!!!
    9·1 answer
  • A man with AB blood has children with a woman with AB blood. What are possible blood types of their children? (select more than
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!