1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mademuasel [1]
3 years ago
5

The vertebrate endoskeleton differs from an arthopod's exoskeleton because it

Biology
1 answer:
Vlada [557]3 years ago
8 0
The vertebrate endoskeleton is internal while an arthropod's exoskeleton is not
You might be interested in
The kingdom that includes euglena the letters are stoprtia
OlgaM077 [116]

Protista

:) <3 (I'm writing this message because my answer was too short.)

6 0
2 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which equation describes the interaction between phenotype, genotype, and the environment?
bagirrra123 [75]

option B:is correct answer

may be this helpful!

3 0
3 years ago
What is meant by the overload principle? what is meant by the overload principle? stretching a muscle group beyond the joint's h
valentinak56 [21]
<span>This principle, or thought process, is that in basic sports fitness programs, all athletes training to continuously improve must always work harder an harder as their bodies become more used to their existing work out routines.</span>
3 0
2 years ago
Determine the averages of the runners
Leona [35]

Answer:

Jaylyn Fly's average is 11

Suzy Swoosh's average is 10.9

Suhain Sprint's average is 10.4

Explanation:

When you need to find an average, you just need to add the numbers up and then divide by the total number of values you added.

3 0
3 years ago
Other questions:
  • When interpreting correlations, it is important to remember that a?
    15·1 answer
  • The number of protons determines the
    10·1 answer
  • How would you classify the relationship between the butterfly fish and the coral polyps?
    7·1 answer
  • Which of the following fruits comes from the fragaria plant?
    9·1 answer
  • What caused life on earth to become more complex
    9·2 answers
  • What does the word competition mean in biology?
    10·1 answer
  • Since nuclear power is clean, why is it not used more extensively in the United States?
    7·1 answer
  • A group of scientists determines that a mitochondrial DNA sequence shared by two species has a constant mutation rate. The seque
    8·2 answers
  • The Earth’s atmosphere consists of a combination of gases. Scientists believe that we are creating air pollution, which causes a
    13·1 answer
  • Another question, tysm.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!