1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
3 years ago
11

Check all answers that apply. Instructions for making proteins are stored in

Biology
2 answers:
Serjik [45]3 years ago
5 0
Instructions for making proteins are stored in DNA
loris [4]3 years ago
5 0

The type of RNA that contains the information for making a protein is called messenger RNA (mRNA) because it carries the information, or message, from the DNA out of the nucleus into the cytoplasm.

So the answers are A. and B.

You might be interested in
Both the microscopic organisms seen here are motile. Although they have different methods of locomotion, they use extensions tha
nekit [7.7K]

<span>Protein</span>

<span>Cilia and flagella are made up of microtubules covered by plasma membrane and they projection from the cell. Thus, cilia are flagella are motile and designed to move substances over or around the cell and they can as well move the cell itself. In eukaryotes, they are conserved in their polypeptide composition, structure and function as motile and sensory organelles.</span>

8 0
3 years ago
A scientist studied a population of birds for 10 years. During that time, the population was never fewer than 30 birds and never
ahrayia [7]

Answer:

A particular population limiting factor or factors must have been removed

Explanation:

The population of the birds must have been kept between 30 and 50 individuals by population limiting factors such as the presence of predators within the community or competition for resources such as food or spaces.

For the population to shoot up to 90 all of a sudden, it may be that one or more of the population limiting factors has been removed from the population. <u>It could be that a major predator has been removed from the community or the competition for food/space is now significantly reduced due to more food/space in the community. </u>

3 0
2 years ago
What bias conditions must be present for the normal operation of a transistor amplifier?
Maksim231197 [3]
The bias conditions that must be present for the normal operation of a transistor amplifier will be those in which the emitter-base junction is forward biased, and the collector-base junction will be reverse biased.
<span />
7 0
3 years ago
Which statement below is true of both chloroplasts and mitochondria?
MissTica

Answer:

Its either B or D but i think its B

Explanation:

i hope it B if not then its D

7 0
3 years ago
In which stage of the cell cycle is this cell?
Ber [7]

Answer:

its interphase edge 2020 got it right

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Ally thinks she is pregnant because she has not had her period in two months. the hormone responsible for her lack of menstruati
    9·1 answer
  • A species of a hippo mates once a year every February 14. in the same community a different species of hippo mates a year in mar
    9·2 answers
  • Which statement correctly describes the diagram?
    12·2 answers
  • Both insects and roundworms exhibit ______, whereas sponges, snails, and leeches do not.
    5·1 answer
  • What is true of macroevolution?
    6·1 answer
  • Which organelle produces sugar while releasing oxygen, and in which cell could it be found?​
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Sebaceous glands are classified as ______ and are functionally classified as _________?
    13·1 answer
  • Which is composed of amino acids and determines all the structures and functions of organisms?
    5·2 answers
  • Define the following ecological term biosphere​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!