1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna11 [10]
4 years ago
12

What are the pros and cons of GMO's

Biology
2 answers:
AlexFokin [52]4 years ago
8 0

Answer:

PROS

More nutritious food

Tastier food

Disease- and drought-resistant plants that require fewer environmental resources (such as water and fertilizer)

Less use of pesticides

Increased supply of food with reduced cost and longer shelf life

Faster growing plants and animals

Food with more desirable traits, such as potatoes that produce less of a cancer-causing substance when fried

Medicinal foods that could be used as vaccines or other medicines

CONS

Studies have shown that genetically modified corn and soy fed to rats led to a higher risk of them developing liver and kidney problems. These health risks may not be transferable to humans, but they illustrate the unpredictable nature of GMOs on living things.

GMOs are not always tested thoroughly. The shortest GMO testing times are a mere 90 days, which many fear is simply not enough time to ascertain all of the risks.

Transgenic modification produces organism types which would never occur naturally, making them highly unpredictable.

GMOs could affect those with allergies in unpredictable ways.

Though GMOs were developed with a view to reducing the amount of pesticides used, this is not always the case. As weeds and bacteria become resistant to the pesticide, farmers actually use more, safe in the knowledge the crop will not be affected.

Often GMO products are not clearly labelled, meaning people do not have the choice to decide whether or not they wish to consume GMO products.

GMO testing often involves performing experiments upon animals, which some people feel is a breach of animal rights.

Explanation:

Inessa05 [86]4 years ago
7 0

Answer: A pro '' Easier to ship and resistance to pest.'' A con '' Environmental risk and only rich countries can afford it.''

Explanation:

You might be interested in
HELP All atoms and molecules have mass and therefore _____________
Damm [24]

Therefore they are consider matter. Remember anything with a mass is matter.

3 0
3 years ago
Read 2 more answers
Is cutting down trees eco-friendly?
cricket20 [7]

Answer:

<u>Yes it can be eco-friendly, but under certain conditions.</u>

Explanation:

Everyone will have their own opinion to whether it's eco-friendly, but some believe that in the long run, cutting down trees and not re-planting them is the problem.

I hope I could help!

4 0
4 years ago
Read 2 more answers
What defines a group of interbreeding individuals that are reproductively isolated from other such groups?
Vika [28.1K]

Answer:

Biological species.

Explanation:

Various concept like morphology species concept, ecological species concept was introduced by the scientists to explain the biological species. The biological species concept is accepted today.

The biological species concept explains that the group of interbreeding population that has the ability to reproductively isolated from the other such group.

Thus, the correct answer is option (c).

4 0
3 years ago
Which two organ systems help provide materials that are necessary for cellular respiration? *
sergejj [24]

Answer:

A

Explanation:

6 0
3 years ago
What is the simplest type of passive transport
Travka [436]
[ Equilibrium / Diffusion ] is the simplest type of passive transport. 7. The diffusion of water through a selectively permeable membrane is called [ osmosis / diffusion ].
5 0
3 years ago
Other questions:
  • What would happen to the size of the carnivore population if the herbivore population increased?
    9·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • The energy consumed by organisms remains constant at all trophies levels? True or false
    6·1 answer
  • PLEASE HELP ASAP
    14·1 answer
  • What did you include in your response?
    10·1 answer
  • Why is water pollution an issue?
    11·2 answers
  • Fill in the blank
    11·1 answer
  • Please help
    15·1 answer
  • Objects in the solar system have similarities and differences. which of the following statements best describes how Jupiter and
    15·1 answer
  • Surface waves travel faster than body waves. O True O False​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!