1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mars1129 [50]
3 years ago
8

Why is Claire (the dog) not gaining weight, even though she is eating?

Biology
1 answer:
iren [92.7K]3 years ago
5 0

Answer:

Claire is a healthy dog

Explanation:

she exercises enough to maintain a healthy and consistent weight.

You might be interested in
What is a balanced equation for the process of photosynthesis ?
Crazy boy [7]
Glucose + oxygen. 6CO2 + 6H2O → C6H12O6 + 6O2.
6 0
3 years ago
Now that you have your mRNA strand, what cell part is the new strand headed to?
tekilochka [14]
C. Nucleus, because RNA is DNA with only 1 backbone, and DNA and RNA lives in the RNA. We only hope that it has the correct marshmellows!
3 0
3 years ago
Read 2 more answers
Sequence the skeletal and muscular changes that take place when a person inhales
o-na [289]
During inhalation, you breathe in and this contracts the diaphragm and moves downwards. This increments the chest cavity space which means the lungs are expanding. The intercostal muscles or the muscles in between the ribs also aids in the enlargement of the chest cavity. Both muscles contract to pull your rib cage upward and outward when you inhale. As your lungs expand, air is sucked through your nose and mouth. It then travels down to the windpipe and into the lungs to the bronchus, bronchioles and eventually in the alveoli where air exchange between carbon dioxide and oxygen happens.

The additional accessory muscles of respiration are typically used only under conditions that are of high metabolic demand or respiratory dysfunction. However, in instances where these muscles become stiff and hard, expansion of the rib cage can be quite restricted. The accessory muscles of respiration include sternocleidomastoid and the scalene muscles namely anterior, middle and posterior scalene. Both aid in elevating the rib cage. However, their involvement seems to depend on the degree of respiratory effort. During quiet breathing, the scalenes are consistently active at certain phases while the sternocleidomastoid is quite.



6 0
3 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
2 years ago
Which is part of the Theory of Evolution by Natural Selection?
uysha [10]

Answer:

b

Explanation:

3 0
3 years ago
Other questions:
  • Discuss the term "survival of the fittest" was developed and what it means.
    9·2 answers
  • Which action would control bleeding through the use of pressure points?
    5·1 answer
  • Discuss the three stages of interphase and the events which occur within each stage.
    9·1 answer
  • What is the greek word for geo 5th grade home work
    5·1 answer
  • Which element would you expect to have a full valence shell?
    11·1 answer
  • Bacteria provide genetic engineers with __ and __
    9·1 answer
  • Why is it bad to litter?
    14·2 answers
  • Count the baby's fingers. His parents both have five fingers on each hand. Six fingers is a dominant trait. Is it possible for t
    11·1 answer
  • Although much of the equipment used by dentists is thrown away after one use, many of the instruments used to clean teeth, fill
    7·1 answer
  • 1. How<br>or an<br>alkali<br>you test to see if a liquid is an acid​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!