1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cluponka [151]
3 years ago
12

Consider the uninoculated tube.

Biology
1 answer:
Nostrana [21]3 years ago
3 0

The uninoculated tube is considered to be a negative control because a negative control is an effect of having to show no response. Am uninoculated control is where  organisms are not being inoculated such as having a culture bacteria of not being inoculated with an organism.

You might be interested in
Which micro-organisms are used to make bread soft and fluffy? Briefly describe how this happens.
Stells [14]

Answer:

Yeast is used to make the bread soft and fluffy . Yeast cells thrive on simple sugars . As the sugars are metabolized , Carbon dioxide and alcohol are released into the bread dough making it rise . So the bread becomes soft and fluffy. The baker made great bread.

Explanation:

8 0
3 years ago
Petra is working on a project that is looking for ways to improve milk yield in cows. What is Petra's job title?
Maksim231197 [3]
A.
Animal scientists applies principles of the biological, physical, and social sciences to the problems associated with livestock production and management.
5 0
2 years ago
Read 2 more answers
Heat energy is also called ___________ energy.
IgorC [24]

Answer:

thermal

Explanation:

6 0
3 years ago
Read 2 more answers
These bacteria change the nitrogen in the atmosphere into a form that we can use to make proteins
Dmitry_Shevchenko [17]

Answer:

Cyanobacteria, Anabaena and Azotobactor are called Nitrogen fixing bacteria. These bacteria change the nitrogen in the atmosphere into a form that is used by the plants to make proteins. Plants take nitrogen in the form of nitrates. The atmospheric nitrogen is first converted into ammonia after that ammonia is converted into nitrates and this nitrates use by the plants to make proteins.

6 0
2 years ago
HELP PLEASE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!<br> What kind of signals occur in the brain?
marin [14]

Answer:

there are all kinds of signals occur in the brain

Explanation:

Hope this help not sure if it is the right answer

5 0
3 years ago
Read 2 more answers
Other questions:
  • What climate condition occurs during el Nino
    7·2 answers
  • Explain why abiotic factors are important in an ecosystem
    13·1 answer
  • Which is NOT a reason why Earth was molten in its early days?
    11·1 answer
  • Lowering a streams base level will cause the stream to
    15·1 answer
  • What is the purpose of the uninoculated control tubes used in the oxidation fermentation test? why is it necessary to use two co
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The trait which is hidden by the dominant allele in a heterozygous individual is said to be a ___________ trait.
    14·1 answer
  • PLS HELP ME pls SO IT SAYS READ the text and say how the adaption is occured in hummingburs and how they were savory flavors but
    15·1 answer
  • A Chemical bond means the sharing or transferring of what particles between
    12·1 answer
  • Select the correct answer. What are the x-intercepts of this quadratic function? g(x) = -2(x − 4)(x + 1) A. (4,0) and (1,0) B. (
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!