1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liraira [26]
4 years ago
14

The surface of the skin can be mapped into distinct regions, each served by a single spinal nerve: these regions are called:

Biology
1 answer:
Ivan4 years ago
6 0

Answer:

The correct answer is D. The surface of the skin can be mapped into distinct regions, each served by a single spinal nerve: these regions are called dermatomes.

Explanation:

A dermatome is the area of skin innervated by a single spinal nerve and its spinal ganglion. The cutaneous nerves are those that reach the skin, picking up the sensitivity of the skin. Each cutaneous nerve is distributed in a certain area of skin, called a dermatome.

A pair of posterior or sensory roots and a pair of anterior or motor roots arise from each cord segment, joining laterally at the level of the intervertebral foramen to form a mixed spinal nerve. Each of these innervates a strip of skin called a dermatome, so the body surface can be considered a true mosaic of these.

In the extremities the arrangement of dermatomes is more complicated because of the embryological rotation of the limbs as they grow from the trunk.

You might be interested in
How many elements have been found to occur in nature?<br> 90<br> 092<br> 96<br> 99
wel

Answer:

92

Explanation:

5 0
3 years ago
Read 2 more answers
Please help if anyone knows:)
Rasek [7]

Answer:

Hi! I think that it is D. I am not 100% sure on it though so I'm so sorry if thats

wrong. Hope this helps though!

3 0
3 years ago
How are the reproductive cycles of a fungus and a pteridophyte similar?​
zubka84 [21]

Answer: In diploid stage the two spores fuse together to form a prothallus which is a diploid stage. Hence, the similarity in the reproductive cycle of fungus and a pteridophyte is that both organisms produce haploid spores and exhibit diploid and haploid stages

Explanation:

7 0
3 years ago
Stars forming in molecular clouds tend to form first in the low-density periphery.
Scilla [17]
The answer is would b a true
4 0
3 years ago
Which group of cells would be least likely to contain cells in S phase? a. Wound repair b. Asexual reproduction to produce a clo
asambeis [7]

Answer:

d. No longer dividing cells of the mammalian brain

Explanation:

Cell cycle consists of events that lead to the duplication of DNA and division of cell into two daughter cells. It occurs in the zygote to make more cells for building an organism. It also occurs in skin, blood and other internal organs for self renewal.

It consists of G1, S, G2 and M phase. DNA replication occurs in S phase of cell which means that it is in the process of dividing. No longer dividing cells of mammalian brain have exited the cell cycle and are in resting phase which is also called as G0. They cant form new cells hence wont have DNA replication. Thus, these cells would be least likely to contain cells in S phase.

8 0
4 years ago
Other questions:
  • how can products and reactants have different amounts of energy without violating the law of conservation of energy
    11·2 answers
  • Compare the accuracy between electronic balance and double pan balance?
    7·1 answer
  • Which organelle releases chemicals that break down large food particles into smaller ones?
    6·1 answer
  • Which cell feature is responsible for making proteins?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • During this phase of cell division, the centromeres split leading to separation and subsequent migration of the two members of a
    14·2 answers
  • The two sides of the DNA molecule are held together across the center of 1 point
    15·1 answer
  • Fibrocartilage is designed to withstand repeated compressive forces. Fibrocartilage is designed to withstand repeated compressiv
    8·1 answer
  • What type of plant hormone is GA-3?​
    9·1 answer
  • If one nerve stimulus arrives at a muscle fiber so soon that the fiber does NOT relax at all from the previous twitch, the most
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!