Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
You mean what is the name of this complex? snRNP - small nuclear ribonucleoprotein
Answer:
C. Prescribed forest fires promoting healthy ecosystems.
Explanation:
This is because at that particular prescription,the place must have been analysed and proved that the forest fires would create more good to ecosystems than harm.
<span>This is incredibly true. The top way to level up, or receive a promotion, is to have proper communication. The three most important things to keep in mind to have effective communication so you may move forward is to be purposeful, be responsible in what and how you communicate, and to always be honest and up front.</span>